Incidental Mutation 'R6529:Sult1a1'
ID522192
Institutional Source Beutler Lab
Gene Symbol Sult1a1
Ensembl Gene ENSMUSG00000030711
Gene Namesulfotransferase family 1A, phenol-preferring, member 1
SynonymsStp1, PST
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.633) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126672865-126676432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126675138 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 91 (T91A)
Ref Sequence ENSEMBL: ENSMUSP00000121514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032956] [ENSMUST00000106371] [ENSMUST00000106372] [ENSMUST00000106373] [ENSMUST00000155419] [ENSMUST00000205507] [ENSMUST00000206359]
Predicted Effect probably benign
Transcript: ENSMUST00000032956
SMART Domains Protein: ENSMUSP00000032956
Gene: ENSMUSG00000030714

DomainStartEndE-ValueType
coiled coil region 66 86 N/A INTRINSIC
Pfam:DUF1325 158 288 5.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106371
AA Change: T91A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101979
Gene: ENSMUSG00000030711
AA Change: T91A

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 256 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106372
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101980
Gene: ENSMUSG00000030711
AA Change: T98A

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 41 263 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106373
AA Change: T91A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101981
Gene: ENSMUSG00000030711
AA Change: T91A

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 284 1.1e-89 PFAM
Pfam:Sulfotransfer_3 36 210 2.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123382
Predicted Effect probably benign
Transcript: ENSMUST00000129786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152231
Predicted Effect probably benign
Transcript: ENSMUST00000155419
AA Change: T91A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121514
Gene: ENSMUSG00000030711
AA Change: T91A

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 121 6e-23 PFAM
Pfam:Sulfotransfer_1 133 181 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205507
Predicted Effect probably benign
Transcript: ENSMUST00000206359
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decrease hepatic DNA adduct formation induced by methyleugenol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Sult1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Sult1a1 APN 7 126675279 missense possibly damaging 0.65
IGL03157:Sult1a1 APN 7 126675317 missense probably damaging 1.00
R6056:Sult1a1 UTSW 7 126676452 unclassified probably null
R6407:Sult1a1 UTSW 7 126673184 unclassified probably null
R7237:Sult1a1 UTSW 7 126673450 missense probably benign 0.01
X0066:Sult1a1 UTSW 7 126674406 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTGAGACATGGTCTTGGAC -3'
(R):5'- GATATGATCTATCAGGGTGGCAAG -3'

Sequencing Primer
(F):5'- TGTGTAGCCAGTTGCCCC -3'
(R):5'- TGGCAAGCTAGATAAGTGTGGCC -3'
Posted On2018-06-06