Incidental Mutation 'R6556:Sstr1'
ID522195
Institutional Source Beutler Lab
Gene Symbol Sstr1
Ensembl Gene ENSMUSG00000035431
Gene Namesomatostatin receptor 1
SynonymsSmstr-1, sst1, Smstr1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location58211772-58214444 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58213692 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 367 (D367V)
Ref Sequence ENSEMBL: ENSMUSP00000106299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044299] [ENSMUST00000110671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044299
AA Change: D367V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037045
Gene: ENSMUSG00000035431
AA Change: D367V

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 297 4.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 2.2e-65 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110671
AA Change: D367V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106299
Gene: ENSMUSG00000035431
AA Change: D367V

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 299 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 4.1e-70 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.8e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. The protein encoded by this gene is a member of the superfamily of somatostatin receptors having seven transmembrane segments. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This somatostatin receptor has greater affinity for somatostatin-14 than -28. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display abnormal eye electrophysiology. Mice homozygous for a second targeted mutation display hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Sstr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sstr1 APN 12 58212750 missense probably benign
IGL01975:Sstr1 APN 12 58213626 missense probably benign 0.01
R0019:Sstr1 UTSW 12 58213149 missense probably damaging 1.00
R0019:Sstr1 UTSW 12 58213149 missense probably damaging 1.00
R0026:Sstr1 UTSW 12 58212858 missense probably damaging 1.00
R0083:Sstr1 UTSW 12 58213742 missense possibly damaging 0.85
R1218:Sstr1 UTSW 12 58213620 missense possibly damaging 0.68
R1254:Sstr1 UTSW 12 58213322 missense possibly damaging 0.93
R1815:Sstr1 UTSW 12 58213478 missense possibly damaging 0.81
R2318:Sstr1 UTSW 12 58212776 missense possibly damaging 0.77
R4588:Sstr1 UTSW 12 58213631 missense probably benign 0.00
R5041:Sstr1 UTSW 12 58213155 missense possibly damaging 0.94
R7332:Sstr1 UTSW 12 58213386 missense probably damaging 1.00
R7342:Sstr1 UTSW 12 58213670 missense possibly damaging 0.95
R7380:Sstr1 UTSW 12 58213280 missense probably benign 0.01
R7452:Sstr1 UTSW 12 58213356 missense probably damaging 1.00
R7873:Sstr1 UTSW 12 58213527 missense probably damaging 1.00
R7956:Sstr1 UTSW 12 58213527 missense probably damaging 1.00
Z1176:Sstr1 UTSW 12 58213526 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCCAGTTGTCTGTCATCCTG -3'
(R):5'- CTTTGGTCCAGCTAACCAGG -3'

Sequencing Primer
(F):5'- GTCTGTCATCCTGGGCTATGC -3'
(R):5'- GCATCGCTGTCATGCACTATG -3'
Posted On2018-06-06