Incidental Mutation 'R6556:Med30'
ID522203
Institutional Source Beutler Lab
Gene Symbol Med30
Ensembl Gene ENSMUSG00000038622
Gene Namemediator complex subunit 30
SynonymsTrap25, 2510044J04Rik, Thrap6, 1810038N03Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6556 (G1)
Quality Score86.0076
Status Not validated
Chromosome15
Chromosomal Location52712408-52730564 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 52730383 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037115]
Predicted Effect probably benign
Transcript: ENSMUST00000037115
SMART Domains Protein: ENSMUSP00000042204
Gene: ENSMUSG00000038622

DomainStartEndE-ValueType
Pfam:Med30 29 176 3.9e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multiprotein TRAP/Mediator complex facilitates gene expression through a wide variety of transcriptional activators. MED30 is a component of this complex that appears to be metazoan specific (Baek et al., 2002 [PubMed 11909976]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit premature death associated with cachexia and a rapidly progressive cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Med30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Med30 APN 15 52721060 missense probably benign 0.12
IGL02657:Med30 APN 15 52719365 missense probably benign 0.08
zeitgeist UTSW 15 52712639 missense probably damaging 1.00
R5519:Med30 UTSW 15 52721066 missense probably damaging 1.00
R5539:Med30 UTSW 15 52721066 missense probably damaging 1.00
R7997:Med30 UTSW 15 52730071 missense probably damaging 1.00
R8179:Med30 UTSW 15 52712568 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTACTCATGTGATGAAGTTGG -3'
(R):5'- AATTTGTGCCTTCAAATCGCC -3'

Sequencing Primer
(F):5'- ACTCATGTGATGAAGTTGGGTTTTTC -3'
(R):5'- TCAGAAAAACGCGTTAAGATCATG -3'
Posted On2018-06-06