Incidental Mutation 'R6556:4930539E08Rik'
ID522208
Institutional Source Beutler Lab
Gene Symbol 4930539E08Rik
Ensembl Gene ENSMUSG00000048905
Gene NameRIKEN cDNA 4930539E08 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location28896392-28915324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28904611 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 114 (D114V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062357]
Predicted Effect probably damaging
Transcript: ENSMUST00000062357
AA Change: D371V

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050646
Gene: ENSMUSG00000048905
AA Change: D371V

DomainStartEndE-ValueType
Pfam:CF222 31 669 1.6e-289 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125317
Predicted Effect probably damaging
Transcript: ENSMUST00000228025
AA Change: D114V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in 4930539E08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03040:4930539E08Rik APN 17 28915202 missense probably benign 0.01
R4163:4930539E08Rik UTSW 17 28899529 missense probably benign 0.04
R4667:4930539E08Rik UTSW 17 28908313 missense possibly damaging 0.94
R4918:4930539E08Rik UTSW 17 28908363 missense probably benign 0.08
R4942:4930539E08Rik UTSW 17 28903258 missense probably benign
R5950:4930539E08Rik UTSW 17 28905755 missense possibly damaging 0.84
R6073:4930539E08Rik UTSW 17 28904623 missense probably damaging 0.99
R7392:4930539E08Rik UTSW 17 28908377 missense probably benign 0.01
R7404:4930539E08Rik UTSW 17 28905324 missense probably damaging 1.00
R7405:4930539E08Rik UTSW 17 28905324 missense probably damaging 1.00
R7473:4930539E08Rik UTSW 17 28905324 missense probably damaging 1.00
R7541:4930539E08Rik UTSW 17 28905324 missense probably damaging 1.00
R7544:4930539E08Rik UTSW 17 28905324 missense probably damaging 1.00
R7562:4930539E08Rik UTSW 17 28909804 missense probably benign 0.02
R7588:4930539E08Rik UTSW 17 28905456 missense probably benign 0.09
R8293:4930539E08Rik UTSW 17 28902890 missense probably benign 0.05
R8355:4930539E08Rik UTSW 17 28903275 missense probably damaging 1.00
R8432:4930539E08Rik UTSW 17 28899571 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAATGGCAGAGTCTAGACAG -3'
(R):5'- ACAGTTCTTTTCATGCAGAGAGC -3'

Sequencing Primer
(F):5'- CAGAGTCTAGACAGATGGGCTATTTG -3'
(R):5'- AGAGCATGGTCGGGGTC -3'
Posted On2018-06-06