Incidental Mutation 'R6529:Gtf3c6'
ID522209
Institutional Source Beutler Lab
Gene Symbol Gtf3c6
Ensembl Gene ENSMUSG00000019837
Gene Namegeneral transcription factor IIIC, polypeptide 6, alpha
Synonyms2410016F19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40247703-40258108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40251255 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 34 (T34A)
Ref Sequence ENSEMBL: ENSMUSP00000150763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019982] [ENSMUST00000045114] [ENSMUST00000181995] [ENSMUST00000183052] [ENSMUST00000183114] [ENSMUST00000183309] [ENSMUST00000213628] [ENSMUST00000216847] [ENSMUST00000217141] [ENSMUST00000217537]
Predicted Effect probably benign
Transcript: ENSMUST00000019982
AA Change: T97A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000019982
Gene: ENSMUSG00000019837
AA Change: T97A

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
Pfam:TFIIIC_sub6 51 84 7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045114
SMART Domains Protein: ENSMUSP00000035456
Gene: ENSMUSG00000038510

DomainStartEndE-ValueType
Brix 1 195 3.25e-51 SMART
low complexity region 208 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181995
SMART Domains Protein: ENSMUSP00000138425
Gene: ENSMUSG00000038510

DomainStartEndE-ValueType
Brix 34 202 8.11e-29 SMART
low complexity region 215 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183052
SMART Domains Protein: ENSMUSP00000138646
Gene: ENSMUSG00000038510

DomainStartEndE-ValueType
Brix 34 175 6.08e-10 SMART
low complexity region 188 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183114
SMART Domains Protein: ENSMUSP00000138750
Gene: ENSMUSG00000038510

DomainStartEndE-ValueType
Brix 3 149 1.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183309
SMART Domains Protein: ENSMUSP00000138581
Gene: ENSMUSG00000038510

DomainStartEndE-ValueType
Brix 34 228 3.25e-51 SMART
low complexity region 241 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213628
AA Change: T34A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000216847
AA Change: T34A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217141
AA Change: T34A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217457
Predicted Effect probably benign
Transcript: ENSMUST00000217537
AA Change: T96A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RNA polymerases are unable to initiate RNA synthesis in the absence of additional proteins called general transcription factors (GTFs). GTFs assemble in a complex on the DNA promoter and recruit the RNA polymerase. GTF3C family proteins (e.g., GTF3C1, MIM 603246) are essential for RNA polymerase III to make a number of small nuclear and cytoplasmic RNAs, including 5S RNA (MIM 180420), tRNA, and adenovirus-associated (VA) RNA of both cellular and viral origin.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wdr46 T A 17: 33,949,146 L564Q possibly damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Gtf3c6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Gtf3c6 APN 10 40254474 splice site probably benign
IGL03063:Gtf3c6 APN 10 40251159 missense probably benign 0.41
IGL03178:Gtf3c6 APN 10 40249722 missense probably benign 0.01
Drumpf UTSW 10 40251173 missense probably null 1.00
R2850:Gtf3c6 UTSW 10 40254258 splice site probably benign
R3440:Gtf3c6 UTSW 10 40251173 missense probably null 1.00
R3441:Gtf3c6 UTSW 10 40251173 missense probably null 1.00
R3442:Gtf3c6 UTSW 10 40251173 missense probably null 1.00
R3842:Gtf3c6 UTSW 10 40254321 splice site probably null
R6856:Gtf3c6 UTSW 10 40249672 missense probably benign 0.00
R6996:Gtf3c6 UTSW 10 40249778 missense probably benign 0.45
X0017:Gtf3c6 UTSW 10 40251277 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGTGCTCATGTCAATGTGTC -3'
(R):5'- TTGTGCCTTCAAATGTCAGTG -3'

Sequencing Primer
(F):5'- ACATGCTAGGCAAGTGCTC -3'
(R):5'- GTGCCTTCAAATGTCAGTGTTATC -3'
Posted On2018-06-06