Incidental Mutation 'R6556:Cabyr'
ID522210
Institutional Source Beutler Lab
Gene Symbol Cabyr
Ensembl Gene ENSMUSG00000024430
Gene Namecalcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2)
SynonymsFSP-2, 4933421A18Rik, CBP86, 1700016C01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12741324-12755146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12751016 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 187 (S187T)
Ref Sequence ENSEMBL: ENSMUSP00000140894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000080415] [ENSMUST00000115857] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119108] [ENSMUST00000121018] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000121888] [ENSMUST00000150758] [ENSMUST00000186263] [ENSMUST00000191078]
Predicted Effect probably benign
Transcript: ENSMUST00000074352
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080415
AA Change: S187T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000079277
Gene: ENSMUSG00000024430
AA Change: S187T

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115857
AA Change: S187T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111523
Gene: ENSMUSG00000024430
AA Change: S187T

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.2e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117361
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118313
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119043
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119108
SMART Domains Protein: ENSMUSP00000113760
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 8.5e-13 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121018
SMART Domains Protein: ENSMUSP00000113131
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 6.7e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121774
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121808
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121888
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150758
AA Change: S187T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118330
Gene: ENSMUSG00000024430
AA Change: S187T

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186263
AA Change: S187T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140870
Gene: ENSMUSG00000024430
AA Change: S187T

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191078
AA Change: S187T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140894
Gene: ENSMUSG00000024430
AA Change: S187T

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] To reach fertilization competence, spermatozoa undergo a series of morphological and molecular maturational processes, termed capacitation, involving protein tyrosine phosphorylation and increased intracellular calcium. The protein encoded by this gene localizes to the principal piece of the sperm flagellum in association with the fibrous sheath and exhibits calcium-binding when phosphorylated during capacitation. A pseudogene on chromosome 3 has been identified for this gene. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout affects sperm flagellum morphology, resulting in reduced sperm motility. These mutant males are subfertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Csnk1g3 A G 18: 53,930,282 D255G possibly damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Cabyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Cabyr APN 18 12744610 missense probably damaging 0.99
R0547:Cabyr UTSW 18 12751016 missense probably benign 0.07
R0571:Cabyr UTSW 18 12750852 missense probably damaging 1.00
R1556:Cabyr UTSW 18 12744780 missense probably damaging 1.00
R3084:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3085:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3086:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3824:Cabyr UTSW 18 12751690 missense probably benign 0.04
R3898:Cabyr UTSW 18 12751523 missense probably benign 0.00
R4869:Cabyr UTSW 18 12751818 makesense probably null
R4933:Cabyr UTSW 18 12744492 splice site probably benign
R5036:Cabyr UTSW 18 12751246 missense probably damaging 1.00
R5482:Cabyr UTSW 18 12751439 missense possibly damaging 0.95
R5932:Cabyr UTSW 18 12754350 missense probably damaging 1.00
R6515:Cabyr UTSW 18 12754283 missense possibly damaging 0.93
R6852:Cabyr UTSW 18 12754097 missense probably benign 0.35
R6907:Cabyr UTSW 18 12750912 missense probably benign 0.05
R7193:Cabyr UTSW 18 12751758 missense probably damaging 1.00
R7565:Cabyr UTSW 18 12744599 missense possibly damaging 0.50
R7777:Cabyr UTSW 18 12744771 missense probably damaging 1.00
R7941:Cabyr UTSW 18 12744768 missense probably damaging 1.00
R8243:Cabyr UTSW 18 12750702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTTTCCATCAGTTCATGCTG -3'
(R):5'- TTGGTGGTTCAGCCTCAGAC -3'

Sequencing Primer
(F):5'- CCATCAGTTCATGCTGAAGTACAGTC -3'
(R):5'- TGGTTCAGCCTCAGACACAGG -3'
Posted On2018-06-06