Incidental Mutation 'R6556:Csnk1g3'
ID522212
Institutional Source Beutler Lab
Gene Symbol Csnk1g3
Ensembl Gene ENSMUSG00000073563
Gene Namecasein kinase 1, gamma 3
SynonymsC330049O21Rik, 3300002K07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6556 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location53862113-53955684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53930282 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 255 (D255G)
Ref Sequence ENSEMBL: ENSMUSP00000070259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069597
AA Change: D255G

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070259
Gene: ENSMUSG00000073563
AA Change: D255G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 19 35 N/A INTRINSIC
Pfam:Pkinase 43 304 1.2e-27 PFAM
Pfam:Pkinase_Tyr 43 306 8.9e-16 PFAM
Pfam:CK1gamma_C 329 362 8.7e-9 PFAM
Pfam:CK1gamma_C 358 386 1.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of serine/threonine protein kinases that phosphorylate caseins and other acidic proteins. A related protein in the African clawed frog participates in the transmission of Wnt/beta-catenin signaling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,738 D60G probably damaging Het
2310035C23Rik T A 1: 105,726,440 F845I probably damaging Het
4930539E08Rik T A 17: 28,904,611 D114V probably damaging Het
AF366264 G A 8: 13,837,690 Q134* probably null Het
Atp2a1 G T 7: 126,450,262 P536Q probably benign Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Camkk1 A T 11: 73,033,870 N303I probably benign Het
Cdh13 C T 8: 118,968,187 P259S probably damaging Het
Dennd5b A C 6: 149,014,251 probably null Het
Dnajc14 A G 10: 128,814,631 D528G probably benign Het
Edem1 T C 6: 108,854,357 F593S probably benign Het
Erbb2 G A 11: 98,436,082 D1106N possibly damaging Het
Ermp1 T C 19: 29,612,921 M794V possibly damaging Het
Fam208a T G 14: 27,429,258 Y64D probably benign Het
Fam214b C T 4: 43,033,896 R460H probably damaging Het
Fip1l1 T A 5: 74,547,177 probably null Het
Gm11639 A G 11: 105,008,251 N4343S probably null Het
Gm20730 C T 6: 43,081,542 C112Y probably damaging Het
Gtf2h1 T A 7: 46,808,665 C245S probably damaging Het
Hdhd5 T C 6: 120,523,554 H61R probably benign Het
Ighv1-71 A T 12: 115,742,472 V31E probably damaging Het
Igsf9b T C 9: 27,329,555 F688S probably damaging Het
Iqcd T C 5: 120,602,378 V258A probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lpo G T 11: 87,817,763 Y136* probably null Het
Med30 A G 15: 52,730,383 probably benign Het
Mertk T A 2: 128,776,421 V524D probably benign Het
Olfr1156 T C 2: 87,949,976 I86V probably benign Het
Olfr1261 T A 2: 89,994,173 F260Y probably benign Het
Olfr1263 T C 2: 90,015,094 Y55H probably damaging Het
Pde6b T A 5: 108,421,501 M358K possibly damaging Het
Prep GA G 10: 45,158,314 probably null Het
Prpf4b G A 13: 34,896,032 R793Q probably damaging Het
Rela T A 19: 5,647,338 N524K probably damaging Het
Rnaset2a T C 17: 8,141,648 D74G probably damaging Het
Serinc2 T A 4: 130,258,271 I267F probably damaging Het
Sesn3 T C 9: 14,321,253 F274S possibly damaging Het
Spag1 T C 15: 36,195,407 Y249H probably damaging Het
Sstr1 A T 12: 58,213,692 D367V possibly damaging Het
Tnnt1 T C 7: 4,509,577 E110G probably damaging Het
Tpm1 T A 9: 67,028,169 probably null Het
Unc93b1 T C 19: 3,944,105 V412A probably benign Het
Uox G C 3: 146,624,648 probably null Het
Usp44 T C 10: 93,846,008 Y107H probably benign Het
Other mutations in Csnk1g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Csnk1g3 APN 18 53919003 missense probably damaging 1.00
IGL02148:Csnk1g3 APN 18 53953288 missense probably benign 0.11
IGL02379:Csnk1g3 APN 18 53933492 missense probably benign 0.00
IGL02447:Csnk1g3 APN 18 53895870 missense probably benign 0.26
IGL03172:Csnk1g3 APN 18 53953284 missense possibly damaging 0.48
R0153:Csnk1g3 UTSW 18 53918789 splice site probably benign
R0606:Csnk1g3 UTSW 18 53917028 missense probably damaging 1.00
R1399:Csnk1g3 UTSW 18 53895910 missense probably damaging 0.97
R1435:Csnk1g3 UTSW 18 53906674 splice site probably null
R4829:Csnk1g3 UTSW 18 53895823 missense possibly damaging 0.85
R5552:Csnk1g3 UTSW 18 53932283 missense probably benign 0.04
R6305:Csnk1g3 UTSW 18 53932312 nonsense probably null
R7324:Csnk1g3 UTSW 18 53919018 missense probably damaging 1.00
R7401:Csnk1g3 UTSW 18 53930318 missense probably damaging 1.00
R7545:Csnk1g3 UTSW 18 53895825 missense probably damaging 0.97
R7846:Csnk1g3 UTSW 18 53948105 missense probably benign 0.03
R7968:Csnk1g3 UTSW 18 53895654 start gained probably benign
R8215:Csnk1g3 UTSW 18 53948079 missense probably benign 0.04
R8390:Csnk1g3 UTSW 18 53948078 missense probably benign 0.09
R8400:Csnk1g3 UTSW 18 53953288 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGTACTTCCTGAGAGGCAGTC -3'
(R):5'- GGTCTACACAGTAATTGTTGACAAC -3'

Sequencing Primer
(F):5'- AGAGGCAGTCTTCCTTGGCAAG -3'
(R):5'- TCATGTTCTTCAAAGCACACAG -3'
Posted On2018-06-06