Incidental Mutation 'R6558:Ifi208'
ID522222
Institutional Source Beutler Lab
Gene Symbol Ifi208
Ensembl Gene ENSMUSG00000066677
Gene Nameinterferon activated gene 208
SynonymsPydc3, E430029J22Rik, Pyr-rv1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6558 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173673675-173698395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173683023 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 248 (T248I)
Ref Sequence ENSEMBL: ENSMUSP00000128958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085876] [ENSMUST00000169857]
Predicted Effect probably damaging
Transcript: ENSMUST00000085876
AA Change: T248I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083039
Gene: ENSMUSG00000066677
AA Change: T248I

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
low complexity region 488 504 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169857
AA Change: T248I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128958
Gene: ENSMUSG00000066677
AA Change: T248I

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:HERV-K_REC 502 580 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182880
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 20,963,673 V161A probably damaging Het
Anxa3 A G 5: 96,812,939 probably null Het
Cftr T C 6: 18,222,528 I261T probably damaging Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Cog2 T C 8: 124,550,232 L659P probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cxcl2 T C 5: 90,904,365 L71P probably damaging Het
Cxcl5 A G 5: 90,759,818 E83G probably damaging Het
Dpt A G 1: 164,796,811 Y27C unknown Het
Drc3 A T 11: 60,364,892 I102F probably damaging Het
Fam83h T C 15: 76,004,453 D345G probably damaging Het
Gm14412 G T 2: 177,314,554 T516K probably damaging Het
Grip1 A G 10: 119,454,383 N7D probably benign Het
Hoxc11 T C 15: 102,954,866 L114P probably damaging Het
Htr7 T C 19: 36,057,240 N5S probably damaging Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Map7d1 G A 4: 126,232,909 A798V unknown Het
Mfsd13a T A 19: 46,366,478 N31K probably damaging Het
Myadm T A 7: 3,297,061 I113N probably damaging Het
Myo18a A G 11: 77,850,852 E1509G probably damaging Het
Nalcn C G 14: 123,486,507 R382P probably benign Het
Ogfr C T 2: 180,595,404 P594L possibly damaging Het
Olfr458 T A 6: 42,460,777 M81L probably benign Het
Olfr508 T A 7: 108,630,188 H65Q probably damaging Het
Pkd1l1 C T 11: 8,889,052 M877I probably benign Het
Sec23a A T 12: 59,004,552 S102T probably benign Het
Stoml1 T A 9: 58,256,668 V90E probably damaging Het
Stra8 G A 6: 34,933,040 W111* probably null Het
Timeless T A 10: 128,249,563 V850D probably benign Het
Unc5c A T 3: 141,789,729 D453V probably damaging Het
Xdh T G 17: 73,893,713 T1138P possibly damaging Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Ifi208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ifi208 APN 1 173679038 critical splice donor site probably null
IGL00725:Ifi208 APN 1 173682861 missense possibly damaging 0.86
IGL01952:Ifi208 APN 1 173679031 missense possibly damaging 0.93
IGL02024:Ifi208 APN 1 173683290 missense probably damaging 0.99
IGL02637:Ifi208 APN 1 173678942 missense probably benign 0.15
IGL02829:Ifi208 APN 1 173682840 missense probably damaging 0.99
IGL03216:Ifi208 APN 1 173678941 missense possibly damaging 0.68
IGL03398:Ifi208 APN 1 173683251 missense probably damaging 0.96
FR4304:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4340:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4342:Ifi208 UTSW 1 173677698 small deletion probably benign
R0022:Ifi208 UTSW 1 173683046 missense possibly damaging 0.91
R0468:Ifi208 UTSW 1 173683481 missense probably benign 0.08
R0734:Ifi208 UTSW 1 173683335 missense probably damaging 0.98
R0780:Ifi208 UTSW 1 173682696 missense probably benign 0.06
R1070:Ifi208 UTSW 1 173683044 missense probably damaging 0.99
R1339:Ifi208 UTSW 1 173683238 missense probably damaging 0.99
R1473:Ifi208 UTSW 1 173695654 missense possibly damaging 0.53
R1755:Ifi208 UTSW 1 173677910 missense possibly damaging 0.86
R3012:Ifi208 UTSW 1 173695570 critical splice acceptor site probably null
R3692:Ifi208 UTSW 1 173682872 missense possibly damaging 0.93
R4175:Ifi208 UTSW 1 173682701 missense probably benign 0.01
R4235:Ifi208 UTSW 1 173682911 missense probably benign 0.06
R4749:Ifi208 UTSW 1 173695614 missense possibly damaging 0.70
R4815:Ifi208 UTSW 1 173682837 missense probably damaging 0.96
R5116:Ifi208 UTSW 1 173677983 intron probably benign
R5138:Ifi208 UTSW 1 173690673 missense probably null 0.29
R5210:Ifi208 UTSW 1 173683265 missense probably benign
R5304:Ifi208 UTSW 1 173683608 missense probably benign
R6126:Ifi208 UTSW 1 173677708 missense possibly damaging 0.91
R6915:Ifi208 UTSW 1 173682878 missense probably damaging 1.00
R7513:Ifi208 UTSW 1 173695654 nonsense probably null
R7972:Ifi208 UTSW 1 173678990 missense possibly damaging 0.68
R8143:Ifi208 UTSW 1 173682676 missense possibly damaging 0.91
R8383:Ifi208 UTSW 1 173683509 missense possibly damaging 0.93
R8431:Ifi208 UTSW 1 173683278 missense possibly damaging 0.85
RF027:Ifi208 UTSW 1 173677696 small deletion probably benign
RF029:Ifi208 UTSW 1 173677696 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GGTTTCCAACAACAGCCTCC -3'
(R):5'- TAGTTGAAAGGTCTGGGCACG -3'

Sequencing Primer
(F):5'- CTGGAGCCTACAGAAATATTGTCC -3'
(R):5'- ACGGCTGGGCACTGTTG -3'
Posted On2018-06-06