Incidental Mutation 'R6558:Lrrc71'
ID522230
Institutional Source Beutler Lab
Gene Symbol Lrrc71
Ensembl Gene ENSMUSG00000023084
Gene Nameleucine rich repeat containing 71
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6558 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location87736923-87748625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87742643 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 326 (T326M)
Ref Sequence ENSEMBL: ENSMUSP00000023846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000039476] [ENSMUST00000152006]
Predicted Effect probably benign
Transcript: ENSMUST00000023846
AA Change: T326M

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084
AA Change: T326M

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039476
SMART Domains Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
RhoGEF 768 952 1.11e-65 SMART
PH 996 1111 9.49e-6 SMART
low complexity region 1153 1166 N/A INTRINSIC
low complexity region 1176 1188 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1357 1367 N/A INTRINSIC
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152006
SMART Domains Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174381
Predicted Effect probably benign
Transcript: ENSMUST00000174581
SMART Domains Protein: ENSMUSP00000134711
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
Blast:LRR 67 94 1e-10 BLAST
low complexity region 142 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 20,963,673 V161A probably damaging Het
Anxa3 A G 5: 96,812,939 probably null Het
Cftr T C 6: 18,222,528 I261T probably damaging Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Cog2 T C 8: 124,550,232 L659P probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cxcl2 T C 5: 90,904,365 L71P probably damaging Het
Cxcl5 A G 5: 90,759,818 E83G probably damaging Het
Dpt A G 1: 164,796,811 Y27C unknown Het
Drc3 A T 11: 60,364,892 I102F probably damaging Het
Fam83h T C 15: 76,004,453 D345G probably damaging Het
Gm14412 G T 2: 177,314,554 T516K probably damaging Het
Grip1 A G 10: 119,454,383 N7D probably benign Het
Hoxc11 T C 15: 102,954,866 L114P probably damaging Het
Htr7 T C 19: 36,057,240 N5S probably damaging Het
Ifi208 C T 1: 173,683,023 T248I probably damaging Het
Map7d1 G A 4: 126,232,909 A798V unknown Het
Mfsd13a T A 19: 46,366,478 N31K probably damaging Het
Myadm T A 7: 3,297,061 I113N probably damaging Het
Myo18a A G 11: 77,850,852 E1509G probably damaging Het
Nalcn C G 14: 123,486,507 R382P probably benign Het
Ogfr C T 2: 180,595,404 P594L possibly damaging Het
Olfr458 T A 6: 42,460,777 M81L probably benign Het
Olfr508 T A 7: 108,630,188 H65Q probably damaging Het
Pkd1l1 C T 11: 8,889,052 M877I probably benign Het
Sec23a A T 12: 59,004,552 S102T probably benign Het
Stoml1 T A 9: 58,256,668 V90E probably damaging Het
Stra8 G A 6: 34,933,040 W111* probably null Het
Timeless T A 10: 128,249,563 V850D probably benign Het
Unc5c A T 3: 141,789,729 D453V probably damaging Het
Xdh T G 17: 73,893,713 T1138P possibly damaging Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Lrrc71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Lrrc71 APN 3 87745224 splice site probably null
IGL02387:Lrrc71 APN 3 87743071 missense probably damaging 0.96
IGL02632:Lrrc71 APN 3 87743340 missense probably damaging 1.00
IGL02701:Lrrc71 APN 3 87741772 missense probably benign 0.37
R0372:Lrrc71 UTSW 3 87745777 missense probably benign 0.40
R0505:Lrrc71 UTSW 3 87745699 missense probably damaging 0.98
R0827:Lrrc71 UTSW 3 87742645 splice site probably null
R1511:Lrrc71 UTSW 3 87745484 missense probably benign 0.00
R1541:Lrrc71 UTSW 3 87741841 missense possibly damaging 0.87
R1987:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R2054:Lrrc71 UTSW 3 87742673 missense probably damaging 1.00
R2143:Lrrc71 UTSW 3 87745521 nonsense probably null
R2427:Lrrc71 UTSW 3 87746002 missense probably benign
R3700:Lrrc71 UTSW 3 87745878 splice site probably null
R4073:Lrrc71 UTSW 3 87745262 missense probably benign 0.01
R4231:Lrrc71 UTSW 3 87740991 missense probably benign 0.01
R4431:Lrrc71 UTSW 3 87742836 missense possibly damaging 0.59
R4477:Lrrc71 UTSW 3 87742665 missense probably damaging 0.99
R4562:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4563:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4564:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4724:Lrrc71 UTSW 3 87739174 missense probably damaging 0.97
R4826:Lrrc71 UTSW 3 87743308 missense probably benign 0.33
R5156:Lrrc71 UTSW 3 87745787 missense probably benign 0.07
R5631:Lrrc71 UTSW 3 87739149 missense probably benign 0.00
R6182:Lrrc71 UTSW 3 87745794 missense probably benign 0.41
R6885:Lrrc71 UTSW 3 87742620 splice site probably null
R7036:Lrrc71 UTSW 3 87748386 missense probably benign 0.00
R7199:Lrrc71 UTSW 3 87743077 missense probably damaging 1.00
R7211:Lrrc71 UTSW 3 87743326 missense possibly damaging 0.92
R7634:Lrrc71 UTSW 3 87742974 missense probably damaging 1.00
R7638:Lrrc71 UTSW 3 87741806 missense probably damaging 1.00
R7695:Lrrc71 UTSW 3 87739462 missense probably damaging 1.00
Z1177:Lrrc71 UTSW 3 87742821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTTCGTATCATGCCCAG -3'
(R):5'- TTCAAGACAAGGGAGCACTG -3'

Sequencing Primer
(F):5'- GAACTACGTGCTAGGCAGTATTCC -3'
(R):5'- ACTGAAGCTGGCCGAGGTG -3'
Posted On2018-06-06