Incidental Mutation 'R6530:Efhc1'
ID522231
Institutional Source Beutler Lab
Gene Symbol Efhc1
Ensembl Gene ENSMUSG00000041809
Gene NameEF-hand domain (C-terminal) containing 1
SynonymsmRib72-1, myoclonin1, 1700029F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6530 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location20951626-20990841 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 20961142 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038447] [ENSMUST00000038447]
Predicted Effect probably null
Transcript: ENSMUST00000038447
SMART Domains Protein: ENSMUSP00000042343
Gene: ENSMUSG00000041809

DomainStartEndE-ValueType
DM10 93 198 2.74e-52 SMART
DM10 239 359 3.04e-59 SMART
DM10 416 520 8.05e-50 SMART
SCOP:d1sra__ 538 646 2e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000038447
SMART Domains Protein: ENSMUSP00000042343
Gene: ENSMUSG00000041809

DomainStartEndE-ValueType
DM10 93 198 2.74e-52 SMART
DM10 239 359 3.04e-59 SMART
DM10 416 520 8.05e-50 SMART
SCOP:d1sra__ 538 646 2e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display myoclonus and increased susceptibility to pharmacologically induced seizures. Homozygous mice also display enlarged brain ventricles and reduced hippocampal size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,588,695 L74P possibly damaging Het
Adamtsl4 T C 3: 95,681,054 T575A probably benign Het
Adck5 T G 15: 76,593,847 D224E probably benign Het
Asic4 A G 1: 75,472,335 N376S probably damaging Het
Atl3 T A 19: 7,522,134 D254E probably benign Het
Cacnb2 G T 2: 14,975,167 A274S probably damaging Het
Car2 T C 3: 14,896,731 V159A probably benign Het
Ccdc138 G C 10: 58,544,968 G474R probably damaging Het
Coq7 T C 7: 118,525,335 T203A probably benign Het
Dnah12 T C 14: 26,735,710 I877T probably damaging Het
Dnah7a C T 1: 53,503,697 R2438H probably benign Het
Fbn1 G A 2: 125,389,270 R459C probably damaging Het
Fer1l4 A G 2: 156,047,865 probably null Het
Gm38394 A G 1: 133,659,201 S133P probably damaging Het
Gm5114 G A 7: 39,408,090 P702S probably damaging Het
Gm9047 G A 6: 29,471,951 probably null Het
Inpp5f T A 7: 128,664,078 Y182* probably null Het
Irf6 C T 1: 193,157,349 T44M probably damaging Het
Loxhd1 A G 18: 77,412,151 N87S probably benign Het
Mtrf1 A T 14: 79,402,891 Q162L possibly damaging Het
Myoz3 G T 18: 60,579,520 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Olfr1065 A C 2: 86,445,482 S167A probably benign Het
Parg T C 14: 32,209,199 S176P probably damaging Het
Prdm2 A C 4: 143,134,047 V891G probably benign Het
Rasl10a T A 11: 5,058,367 I21N probably damaging Het
Reg4 T C 3: 98,224,832 V20A probably benign Het
Shprh T A 10: 11,194,267 S1462R probably benign Het
Sult1e1 T C 5: 87,576,288 E270G probably benign Het
Trpm7 A C 2: 126,812,711 F1436V probably damaging Het
Ttc33 A G 15: 5,212,122 probably null Het
Ucp2 A T 7: 100,498,223 E161D probably benign Het
Vmn2r79 T C 7: 87,002,044 F217S possibly damaging Het
Wdr93 G A 7: 79,755,993 A207T probably damaging Het
Zfp949 T C 9: 88,567,287 probably null Het
Other mutations in Efhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Efhc1 APN 1 20979481 nonsense probably null
IGL00549:Efhc1 APN 1 20979481 nonsense probably null
IGL01611:Efhc1 APN 1 20990687 makesense probably null
IGL01916:Efhc1 APN 1 20978749 missense probably damaging 1.00
IGL02366:Efhc1 APN 1 20960262 missense probably damaging 0.99
IGL02567:Efhc1 APN 1 20972964 missense probably damaging 0.98
IGL02590:Efhc1 APN 1 20967384 missense probably damaging 1.00
IGL02869:Efhc1 APN 1 20967343 missense probably damaging 0.96
IGL03264:Efhc1 APN 1 20967491 missense probably benign
IGL03292:Efhc1 APN 1 20960272 missense possibly damaging 0.89
IGL03097:Efhc1 UTSW 1 20972825 missense probably damaging 1.00
P0023:Efhc1 UTSW 1 20955527 missense probably benign
R0180:Efhc1 UTSW 1 20967489 missense probably benign
R0220:Efhc1 UTSW 1 20967358 missense probably damaging 0.98
R0391:Efhc1 UTSW 1 20960188 missense probably damaging 1.00
R0765:Efhc1 UTSW 1 20978652 missense probably benign 0.00
R1293:Efhc1 UTSW 1 20978772 missense probably damaging 0.96
R1414:Efhc1 UTSW 1 20961289 missense probably damaging 1.00
R1644:Efhc1 UTSW 1 20967401 nonsense probably null
R1799:Efhc1 UTSW 1 20979538 missense probably benign 0.00
R1932:Efhc1 UTSW 1 20967400 missense probably damaging 1.00
R1991:Efhc1 UTSW 1 20989560 nonsense probably null
R2103:Efhc1 UTSW 1 20989560 nonsense probably null
R3956:Efhc1 UTSW 1 20978666 missense probably damaging 0.96
R4812:Efhc1 UTSW 1 20990647 missense probably damaging 0.99
R5064:Efhc1 UTSW 1 20974963 missense possibly damaging 0.91
R5562:Efhc1 UTSW 1 20972880 missense probably damaging 0.98
R5800:Efhc1 UTSW 1 20978781 missense probably benign 0.00
R5948:Efhc1 UTSW 1 20972828 missense probably damaging 0.99
R5977:Efhc1 UTSW 1 20960218 missense probably damaging 1.00
R6313:Efhc1 UTSW 1 20979428 missense possibly damaging 0.69
R6375:Efhc1 UTSW 1 20972940 missense probably benign 0.05
R6512:Efhc1 UTSW 1 20960349 missense probably damaging 0.99
R6865:Efhc1 UTSW 1 20960218 missense probably damaging 1.00
R7398:Efhc1 UTSW 1 20989520 missense probably benign
R7676:Efhc1 UTSW 1 20967369 missense probably damaging 1.00
R7719:Efhc1 UTSW 1 20979520 missense probably benign
R7775:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7778:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7824:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCAGACAGTTATCAGCTATC -3'
(R):5'- GACGATGGTTAAATTATATGCAGGC -3'

Sequencing Primer
(F):5'- CAGACAGTTATCAGCTATCATCTGC -3'
(R):5'- TACGTCCACATTTGAACAGGAG -3'
Posted On2018-06-06