Incidental Mutation 'R6530:Irf6'
ID522239
Institutional Source Beutler Lab
Gene Symbol Irf6
Ensembl Gene ENSMUSG00000026638
Gene Nameinterferon regulatory factor 6
SynonymsE230028I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.654) question?
Stock #R6530 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location193153111-193172023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 193157349 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 44 (T44M)
Ref Sequence ENSEMBL: ENSMUSP00000075839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076521]
Predicted Effect probably damaging
Transcript: ENSMUST00000076521
AA Change: T44M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075839
Gene: ENSMUSG00000026638
AA Change: T44M

DomainStartEndE-ValueType
IRF 3 116 1.98e-59 SMART
low complexity region 135 151 N/A INTRINSIC
Blast:IRF 158 189 6e-8 BLAST
IRF-3 223 407 3.92e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140066
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interferon regulatory transcription factor (IRF) family. Family members share a highly-conserved N-terminal helix-turn-helix DNA-binding domain and a less conserved C-terminal protein-binding domain. The encoded protein may be a transcriptional activator. Mutations in this gene can cause van der Woude syndrome and popliteal pterygium syndrome. Mutations in this gene are also associated with non-syndromic orofacial cleft type 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2011]
PHENOTYPE: Mice with mutations of Irf6 display craniofacial, limb, and skin defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,588,695 L74P possibly damaging Het
Adamtsl4 T C 3: 95,681,054 T575A probably benign Het
Adck5 T G 15: 76,593,847 D224E probably benign Het
Asic4 A G 1: 75,472,335 N376S probably damaging Het
Atl3 T A 19: 7,522,134 D254E probably benign Het
Cacnb2 G T 2: 14,975,167 A274S probably damaging Het
Car2 T C 3: 14,896,731 V159A probably benign Het
Ccdc138 G C 10: 58,544,968 G474R probably damaging Het
Coq7 T C 7: 118,525,335 T203A probably benign Het
Dnah12 T C 14: 26,735,710 I877T probably damaging Het
Dnah7a C T 1: 53,503,697 R2438H probably benign Het
Efhc1 T A 1: 20,961,142 probably null Het
Fbn1 G A 2: 125,389,270 R459C probably damaging Het
Fer1l4 A G 2: 156,047,865 probably null Het
Gm38394 A G 1: 133,659,201 S133P probably damaging Het
Gm5114 G A 7: 39,408,090 P702S probably damaging Het
Gm9047 G A 6: 29,471,951 probably null Het
Inpp5f T A 7: 128,664,078 Y182* probably null Het
Loxhd1 A G 18: 77,412,151 N87S probably benign Het
Mtrf1 A T 14: 79,402,891 Q162L possibly damaging Het
Myoz3 G T 18: 60,579,520 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Olfr1065 A C 2: 86,445,482 S167A probably benign Het
Parg T C 14: 32,209,199 S176P probably damaging Het
Prdm2 A C 4: 143,134,047 V891G probably benign Het
Rasl10a T A 11: 5,058,367 I21N probably damaging Het
Reg4 T C 3: 98,224,832 V20A probably benign Het
Shprh T A 10: 11,194,267 S1462R probably benign Het
Sult1e1 T C 5: 87,576,288 E270G probably benign Het
Trpm7 A C 2: 126,812,711 F1436V probably damaging Het
Ttc33 A G 15: 5,212,122 probably null Het
Ucp2 A T 7: 100,498,223 E161D probably benign Het
Vmn2r79 T C 7: 87,002,044 F217S possibly damaging Het
Wdr93 G A 7: 79,755,993 A207T probably damaging Het
Zfp949 T C 9: 88,567,287 probably null Het
Other mutations in Irf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03269:Irf6 APN 1 193162598 splice site probably benign
R0068:Irf6 UTSW 1 193165759 unclassified probably benign
R1317:Irf6 UTSW 1 193169301 missense probably damaging 1.00
R1413:Irf6 UTSW 1 193169305 missense probably benign 0.22
R1761:Irf6 UTSW 1 193169301 missense probably damaging 1.00
R1856:Irf6 UTSW 1 193167535 missense probably benign 0.32
R3712:Irf6 UTSW 1 193162623 missense probably benign 0.00
R3941:Irf6 UTSW 1 193168549 missense probably benign 0.17
R4717:Irf6 UTSW 1 193167434 splice site probably null
R6461:Irf6 UTSW 1 193167471 missense probably damaging 1.00
R6577:Irf6 UTSW 1 193169354 missense probably damaging 1.00
R6883:Irf6 UTSW 1 193167466 missense probably damaging 1.00
R7116:Irf6 UTSW 1 193167597 missense probably damaging 1.00
R7698:Irf6 UTSW 1 193161767 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACTGTAGCCTCAGTACCTG -3'
(R):5'- AGAGGAATCACAATTTGGGCATC -3'

Sequencing Primer
(F):5'- AAAGTTCCCAGTGGCTAGCTC -3'
(R):5'- GGGCATCTTATCATATAGGTTCCGC -3'
Posted On2018-06-06