Incidental Mutation 'R6558:Anxa3'
ID522240
Institutional Source Beutler Lab
Gene Symbol Anxa3
Ensembl Gene ENSMUSG00000029484
Gene Nameannexin A3
SynonymsAnx3
MMRRC Submission
Accession Numbers

Genbank: NM_013470; MGI: 1201378; Ensembl: ENSMUST00000112985

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6558 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location96793339-96845966 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 96812939 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031447] [ENSMUST00000198631] [ENSMUST00000199330] [ENSMUST00000200379]
Predicted Effect probably null
Transcript: ENSMUST00000031447
SMART Domains Protein: ENSMUSP00000031447
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
ANX 191 243 3.67e-22 SMART
ANX 266 318 2.87e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197339
Predicted Effect probably null
Transcript: ENSMUST00000198631
SMART Domains Protein: ENSMUSP00000143491
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199330
SMART Domains Protein: ENSMUSP00000143615
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 35 84 1.5e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199656
Predicted Effect probably null
Transcript: ENSMUST00000200379
SMART Domains Protein: ENSMUSP00000142527
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 24 76 7.2e-28 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions in the inhibition of phopholipase A2 and cleavage of inositol 1,2-cyclic phosphate to form inositol 1-phosphate. This protein may also play a role in anti-coagulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 20,963,673 V161A probably damaging Het
Cftr T C 6: 18,222,528 I261T probably damaging Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Cog2 T C 8: 124,550,232 L659P probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cxcl2 T C 5: 90,904,365 L71P probably damaging Het
Cxcl5 A G 5: 90,759,818 E83G probably damaging Het
Dpt A G 1: 164,796,811 Y27C unknown Het
Drc3 A T 11: 60,364,892 I102F probably damaging Het
Fam83h T C 15: 76,004,453 D345G probably damaging Het
Gm14412 G T 2: 177,314,554 T516K probably damaging Het
Grip1 A G 10: 119,454,383 N7D probably benign Het
Hoxc11 T C 15: 102,954,866 L114P probably damaging Het
Htr7 T C 19: 36,057,240 N5S probably damaging Het
Ifi208 C T 1: 173,683,023 T248I probably damaging Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Map7d1 G A 4: 126,232,909 A798V unknown Het
Mfsd13a T A 19: 46,366,478 N31K probably damaging Het
Myadm T A 7: 3,297,061 I113N probably damaging Het
Myo18a A G 11: 77,850,852 E1509G probably damaging Het
Nalcn C G 14: 123,486,507 R382P probably benign Het
Ogfr C T 2: 180,595,404 P594L possibly damaging Het
Olfr458 T A 6: 42,460,777 M81L probably benign Het
Olfr508 T A 7: 108,630,188 H65Q probably damaging Het
Pkd1l1 C T 11: 8,889,052 M877I probably benign Het
Sec23a A T 12: 59,004,552 S102T probably benign Het
Stoml1 T A 9: 58,256,668 V90E probably damaging Het
Stra8 G A 6: 34,933,040 W111* probably null Het
Timeless T A 10: 128,249,563 V850D probably benign Het
Unc5c A T 3: 141,789,729 D453V probably damaging Het
Xdh T G 17: 73,893,713 T1138P possibly damaging Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Anxa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Anxa3 APN 5 96834771 splice site probably benign
IGL03243:Anxa3 APN 5 96828692 unclassified probably benign
F6893:Anxa3 UTSW 5 96824994 unclassified probably benign
R0026:Anxa3 UTSW 5 96838401 missense probably benign 0.01
R0468:Anxa3 UTSW 5 96811099 missense probably benign 0.00
R0562:Anxa3 UTSW 5 96812884 missense possibly damaging 0.90
R0724:Anxa3 UTSW 5 96828748 missense possibly damaging 0.70
R1442:Anxa3 UTSW 5 96828690 splice site probably null
R2276:Anxa3 UTSW 5 96830490 critical splice donor site probably null
R4922:Anxa3 UTSW 5 96820429 missense probably damaging 1.00
R5108:Anxa3 UTSW 5 96830414 missense possibly damaging 0.83
R5230:Anxa3 UTSW 5 96838312 missense possibly damaging 0.47
R5529:Anxa3 UTSW 5 96828379 missense probably benign 0.00
R5733:Anxa3 UTSW 5 96820472 missense probably damaging 1.00
R5857:Anxa3 UTSW 5 96828792 critical splice donor site probably null
R5902:Anxa3 UTSW 5 96812853 nonsense probably null
R6772:Anxa3 UTSW 5 96811113 missense probably damaging 0.98
R7425:Anxa3 UTSW 5 96834821 missense probably benign 0.30
R7515:Anxa3 UTSW 5 96838320 missense probably damaging 1.00
R7619:Anxa3 UTSW 5 96830404 missense probably damaging 1.00
R8018:Anxa3 UTSW 5 96820429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAACTTGTTTTGGCCCC -3'
(R):5'- TAAGTCACCATTCTTCATTCCACAG -3'

Sequencing Primer
(F):5'- GCCCCCTGAATCTGTTGTTTGAAAC -3'
(R):5'- TCTTCATTCCACAGTGAAGAAGCAG -3'
Posted On2018-06-06