Incidental Mutation 'R6530:Fer1l4'
ID522249
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Namefer-1-like 4 (C. elegans)
Synonyms9130402C12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6530 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location156019139-156052947 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 156047865 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
Predicted Effect probably null
Transcript: ENSMUST00000109611
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,588,695 L74P possibly damaging Het
Adamtsl4 T C 3: 95,681,054 T575A probably benign Het
Adck5 T G 15: 76,593,847 D224E probably benign Het
Asic4 A G 1: 75,472,335 N376S probably damaging Het
Atl3 T A 19: 7,522,134 D254E probably benign Het
Cacnb2 G T 2: 14,975,167 A274S probably damaging Het
Car2 T C 3: 14,896,731 V159A probably benign Het
Ccdc138 G C 10: 58,544,968 G474R probably damaging Het
Coq7 T C 7: 118,525,335 T203A probably benign Het
Dnah12 T C 14: 26,735,710 I877T probably damaging Het
Dnah7a C T 1: 53,503,697 R2438H probably benign Het
Efhc1 T A 1: 20,961,142 probably null Het
Fbn1 G A 2: 125,389,270 R459C probably damaging Het
Gm38394 A G 1: 133,659,201 S133P probably damaging Het
Gm5114 G A 7: 39,408,090 P702S probably damaging Het
Gm9047 G A 6: 29,471,951 probably null Het
Inpp5f T A 7: 128,664,078 Y182* probably null Het
Irf6 C T 1: 193,157,349 T44M probably damaging Het
Loxhd1 A G 18: 77,412,151 N87S probably benign Het
Mtrf1 A T 14: 79,402,891 Q162L possibly damaging Het
Myoz3 G T 18: 60,579,520 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Olfr1065 A C 2: 86,445,482 S167A probably benign Het
Parg T C 14: 32,209,199 S176P probably damaging Het
Prdm2 A C 4: 143,134,047 V891G probably benign Het
Rasl10a T A 11: 5,058,367 I21N probably damaging Het
Reg4 T C 3: 98,224,832 V20A probably benign Het
Shprh T A 10: 11,194,267 S1462R probably benign Het
Sult1e1 T C 5: 87,576,288 E270G probably benign Het
Trpm7 A C 2: 126,812,711 F1436V probably damaging Het
Ttc33 A G 15: 5,212,122 probably null Het
Ucp2 A T 7: 100,498,223 E161D probably benign Het
Vmn2r79 T C 7: 87,002,044 F217S possibly damaging Het
Wdr93 G A 7: 79,755,993 A207T probably damaging Het
Zfp949 T C 9: 88,567,287 probably null Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 156019920 nonsense probably null
IGL01025:Fer1l4 APN 2 156052185 missense probably benign 0.41
IGL01103:Fer1l4 APN 2 156044441 critical splice donor site probably null
IGL01322:Fer1l4 APN 2 156020339 splice site probably null
IGL01391:Fer1l4 APN 2 156036456 missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 156048451 missense probably benign
IGL02267:Fer1l4 APN 2 156031252 missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 156019538 missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 156045428 missense probably benign 0.04
IGL02423:Fer1l4 APN 2 156052907 missense probably benign 0.04
IGL02596:Fer1l4 APN 2 156039132 missense probably benign
IGL02612:Fer1l4 APN 2 156047928 missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 156029715 missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 156045728 missense probably benign
IGL03035:Fer1l4 APN 2 156022606 missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 156039366 unclassified probably benign
IGL03201:Fer1l4 APN 2 156044730 missense probably benign 0.32
IGL03349:Fer1l4 APN 2 156044734 nonsense probably null
R0033:Fer1l4 UTSW 2 156024106 splice site probably benign
R0356:Fer1l4 UTSW 2 156024010 missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 156052886 missense probably benign 0.43
R0504:Fer1l4 UTSW 2 156052195 missense probably benign 0.36
R0731:Fer1l4 UTSW 2 156024070 missense probably benign 0.17
R0800:Fer1l4 UTSW 2 156045663 missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 156019313 missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 156049478 critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 156046249 missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 156045633 missense probably benign 0.00
R1657:Fer1l4 UTSW 2 156035598 missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 156029685 missense probably benign 0.14
R1816:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 156048274 missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 156039118 missense probably benign 0.00
R2219:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 156052200 missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 156035048 missense probably benign 0.01
R3806:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 156020389 missense probably benign 0.37
R4274:Fer1l4 UTSW 2 156020544 missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 156036639 missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 156047087 missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 156045623 missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4915:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4917:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4918:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4941:Fer1l4 UTSW 2 156045089 missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 156049466 missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 156037366 nonsense probably null
R5441:Fer1l4 UTSW 2 156023257 missense probably benign 0.00
R5555:Fer1l4 UTSW 2 156048189 missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 156051993 missense probably benign 0.01
R6125:Fer1l4 UTSW 2 156046987 missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 156048291 missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 156024982 missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 156046171 missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 156029268 missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 156024740 missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 156048250 missense probably benign 0.08
R6490:Fer1l4 UTSW 2 156047914 missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 156045470 missense probably benign 0.02
R6516:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R6740:Fer1l4 UTSW 2 156031222 missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 156036730 missense probably benign 0.05
R7121:Fer1l4 UTSW 2 156044557 missense probably benign 0.13
R7132:Fer1l4 UTSW 2 156045626 missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 156020749 nonsense probably null
R7631:Fer1l4 UTSW 2 156048275 missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 156020431 missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 156048934 missense probably benign
R8021:Fer1l4 UTSW 2 156022591 missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 156024635 missense probably benign 0.03
R8171:Fer1l4 UTSW 2 156048231 missense probably benign 0.29
R8241:Fer1l4 UTSW 2 156049665 missense probably benign
R8245:Fer1l4 UTSW 2 156045014 critical splice donor site probably null
R8280:Fer1l4 UTSW 2 156049700 missense probably damaging 1.00
RF030:Fer1l4 UTSW 2 156045529 small deletion probably benign
X0063:Fer1l4 UTSW 2 156035011 missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 156048429 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGGTGGCCATAAACGG -3'
(R):5'- AAGAGTACGTAGGTGCCTTTTAG -3'

Sequencing Primer
(F):5'- TCTGCGAGTGGAAAGCCTG -3'
(R):5'- CTTTTAGGAAAGGGACCGCATTCTC -3'
Posted On2018-06-06