Mutagenetix > Incidental Mutation

Incidental Mutation 'R6558:Cog2'

522252

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6558 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124550232 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 659 (L659P)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably damaging
Transcript: ENSMUST00000034460
AA Change: L659P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: L659P

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Meta Mutation Damage Score

0.8989

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahi1	T	C	10: 20,963,673	V161A	probably damaging	Het
Anxa3	A	G	5: 96,812,939		probably null	Het
Cftr	T	C	6: 18,222,528	I261T	probably damaging	Het
Chml	A	T	1: 175,687,182	M391K	probably damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Cxcl2	T	C	5: 90,904,365	L71P	probably damaging	Het
Cxcl5	A	G	5: 90,759,818	E83G	probably damaging	Het
Dpt	A	G	1: 164,796,811	Y27C	unknown	Het
Drc3	A	T	11: 60,364,892	I102F	probably damaging	Het
Fam83h	T	C	15: 76,004,453	D345G	probably damaging	Het
Gm14412	G	T	2: 177,314,554	T516K	probably damaging	Het
Grip1	A	G	10: 119,454,383	N7D	probably benign	Het
Hoxc11	T	C	15: 102,954,866	L114P	probably damaging	Het
Htr7	T	C	19: 36,057,240	N5S	probably damaging	Het
Ifi208	C	T	1: 173,683,023	T248I	probably damaging	Het
Lrrc71	G	A	3: 87,742,643	T326M	probably benign	Het
Map7d1	G	A	4: 126,232,909	A798V	unknown	Het
Mfsd13a	T	A	19: 46,366,478	N31K	probably damaging	Het
Myadm	T	A	7: 3,297,061	I113N	probably damaging	Het
Myo18a	A	G	11: 77,850,852	E1509G	probably damaging	Het
Nalcn	C	G	14: 123,486,507	R382P	probably benign	Het
Ogfr	C	T	2: 180,595,404	P594L	possibly damaging	Het
Olfr458	T	A	6: 42,460,777	M81L	probably benign	Het
Olfr508	T	A	7: 108,630,188	H65Q	probably damaging	Het
Pkd1l1	C	T	11: 8,889,052	M877I	probably benign	Het
Sec23a	A	T	12: 59,004,552	S102T	probably benign	Het
Stoml1	T	A	9: 58,256,668	V90E	probably damaging	Het
Stra8	G	A	6: 34,933,040	W111*	probably null	Het
Timeless	T	A	10: 128,249,563	V850D	probably benign	Het
Unc5c	A	T	3: 141,789,729	D453V	probably damaging	Het
Xdh	T	G	17: 73,893,713	T1138P	possibly damaging	Het
Zkscan6	A	T	11: 65,828,225	H357L	probably benign	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ACAGCCCATTTTCCTGTTGAGC -3'
(R):5'- TGACACCTCAGCTTTGCTAG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTTAGGAGGCAG -3'
(R):5'- TTGCTAGCCTGGCCCTCAG -3'

Posted On

2018-06-06