Mutagenetix > Incidental Mutation

Incidental Mutation 'R6558:Col5a3'

522254

Institutional Source

Beutler Lab

Gene Symbol

Col5a3

Ensembl Gene

ENSMUSG00000004098

Gene Name

collagen, type V, alpha 3

Synonyms

Pro-alpha3(V)

MMRRC Submission

044682-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.398) question?

Stock #

R6558 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20681353-20726363 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20690329 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 1162 (G1162R)

Ref Sequence

ENSEMBL: ENSMUSP00000004201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004201]

AlphaFold

Q9JLI2

Predicted Effect

probably damaging
Transcript: ENSMUST00000004201
AA Change: G1162R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098
AA Change: G1162R

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSPN	32	211	7.08e-28	SMART
LamG	89	210	2.13e-2	SMART
low complexity region	247	267	N/A	INTRINSIC
low complexity region	295	314	N/A	INTRINSIC
low complexity region	341	347	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
low complexity region	391	434	N/A	INTRINSIC
low complexity region	461	474	N/A	INTRINSIC
Pfam:Collagen	475	538	5.5e-10	PFAM
low complexity region	597	616	N/A	INTRINSIC
low complexity region	628	694	N/A	INTRINSIC
internal_repeat_3	703	737	7.13e-16	PROSPERO
low complexity region	742	821	N/A	INTRINSIC
low complexity region	823	844	N/A	INTRINSIC
low complexity region	859	889	N/A	INTRINSIC
internal_repeat_2	892	1081	5.05e-17	PROSPERO
internal_repeat_1	996	1133	7.47e-22	PROSPERO
internal_repeat_3	1105	1139	7.13e-16	PROSPERO
low complexity region	1140	1165	N/A	INTRINSIC
low complexity region	1168	1255	N/A	INTRINSIC
low complexity region	1258	1282	N/A	INTRINSIC
low complexity region	1285	1306	N/A	INTRINSIC
low complexity region	1311	1418	N/A	INTRINSIC
Pfam:Collagen	1429	1491	9.5e-10	PFAM
COLFI	1508	1738	7.98e-92	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145974

Meta Mutation Damage Score

0.8243

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahi1	T	C	10: 20,839,572 (GRCm39)	V161A	probably damaging	Het
Anxa3	A	G	5: 96,960,798 (GRCm39)		probably null	Het
Cftr	T	C	6: 18,222,527 (GRCm39)	I261T	probably damaging	Het
Chml	A	T	1: 175,514,748 (GRCm39)	M391K	probably damaging	Het
Cog2	T	C	8: 125,276,971 (GRCm39)	L659P	probably damaging	Het
Cxcl2	T	C	5: 91,052,224 (GRCm39)	L71P	probably damaging	Het
Cxcl5	A	G	5: 90,907,677 (GRCm39)	E83G	probably damaging	Het
Dpt	A	G	1: 164,624,380 (GRCm39)	Y27C	unknown	Het
Drc3	A	T	11: 60,255,718 (GRCm39)	I102F	probably damaging	Het
Fam83h	T	C	15: 75,876,302 (GRCm39)	D345G	probably damaging	Het
Gm14412	G	T	2: 177,006,347 (GRCm39)	T516K	probably damaging	Het
Grip1	A	G	10: 119,290,288 (GRCm39)	N7D	probably benign	Het
Hoxc11	T	C	15: 102,863,301 (GRCm39)	L114P	probably damaging	Het
Htr7	T	C	19: 36,034,640 (GRCm39)	N5S	probably damaging	Het
Ifi208	C	T	1: 173,510,589 (GRCm39)	T248I	probably damaging	Het
Lrrc71	G	A	3: 87,649,950 (GRCm39)	T326M	probably benign	Het
Map7d1	G	A	4: 126,126,702 (GRCm39)	A798V	unknown	Het
Mfsd13a	T	A	19: 46,354,917 (GRCm39)	N31K	probably damaging	Het
Myadm	T	A	7: 3,345,577 (GRCm39)	I113N	probably damaging	Het
Myo18a	A	G	11: 77,741,678 (GRCm39)	E1509G	probably damaging	Het
Nalcn	C	G	14: 123,723,919 (GRCm39)	R382P	probably benign	Het
Ogfr	C	T	2: 180,237,197 (GRCm39)	P594L	possibly damaging	Het
Or2r11	T	A	6: 42,437,711 (GRCm39)	M81L	probably benign	Het
Or5p80	T	A	7: 108,229,395 (GRCm39)	H65Q	probably damaging	Het
Pkd1l1	C	T	11: 8,839,052 (GRCm39)	M877I	probably benign	Het
Sec23a	A	T	12: 59,051,338 (GRCm39)	S102T	probably benign	Het
Stoml1	T	A	9: 58,163,951 (GRCm39)	V90E	probably damaging	Het
Stra8	G	A	6: 34,909,975 (GRCm39)	W111*	probably null	Het
Timeless	T	A	10: 128,085,432 (GRCm39)	V850D	probably benign	Het
Unc5c	A	T	3: 141,495,490 (GRCm39)	D453V	probably damaging	Het
Xdh	T	G	17: 74,200,708 (GRCm39)	T1138P	possibly damaging	Het
Zkscan6	A	T	11: 65,719,051 (GRCm39)	H357L	probably benign	Het

Other mutations in Col5a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Col5a3	APN	9	20,697,685 (GRCm39)	nonsense	probably null
IGL01548:Col5a3	APN	9	20,714,296 (GRCm39)	splice site	probably benign
IGL02164:Col5a3	APN	9	20,703,939 (GRCm39)	critical splice donor site	probably null
IGL02297:Col5a3	APN	9	20,683,450 (GRCm39)	missense	unknown
IGL02333:Col5a3	APN	9	20,710,602 (GRCm39)	missense	unknown
IGL02349:Col5a3	APN	9	20,683,657 (GRCm39)	missense	unknown
IGL02390:Col5a3	APN	9	20,688,292 (GRCm39)	missense	unknown
IGL02685:Col5a3	APN	9	20,683,501 (GRCm39)	missense	unknown
IGL02941:Col5a3	APN	9	20,715,962 (GRCm39)	missense	unknown
IGL03001:Col5a3	APN	9	20,719,040 (GRCm39)	missense	unknown
IGL03061:Col5a3	APN	9	20,708,868 (GRCm39)	critical splice donor site	probably null
IGL03102:Col5a3	APN	9	20,715,931 (GRCm39)	critical splice donor site	probably null
IGL03308:Col5a3	APN	9	20,719,675 (GRCm39)	missense	unknown
IGL03372:Col5a3	APN	9	20,686,624 (GRCm39)	missense	unknown
Guppy	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
minifish	UTSW	9	20,696,882 (GRCm39)	missense	probably damaging	0.99
R0002:Col5a3	UTSW	9	20,721,152 (GRCm39)	critical splice acceptor site	probably null
R0012:Col5a3	UTSW	9	20,688,404 (GRCm39)	splice site	probably benign
R0316:Col5a3	UTSW	9	20,686,621 (GRCm39)	missense	unknown
R0357:Col5a3	UTSW	9	20,719,064 (GRCm39)	splice site	probably benign
R0360:Col5a3	UTSW	9	20,683,762 (GRCm39)	missense	unknown
R0483:Col5a3	UTSW	9	20,693,777 (GRCm39)	splice site	probably null
R0485:Col5a3	UTSW	9	20,694,004 (GRCm39)	missense	probably damaging	0.99
R0627:Col5a3	UTSW	9	20,686,781 (GRCm39)	missense	unknown
R1035:Col5a3	UTSW	9	20,704,795 (GRCm39)	splice site	probably benign
R1051:Col5a3	UTSW	9	20,686,531 (GRCm39)	missense	unknown
R1295:Col5a3	UTSW	9	20,719,714 (GRCm39)	missense	unknown
R1438:Col5a3	UTSW	9	20,691,253 (GRCm39)	missense	probably damaging	0.99
R1622:Col5a3	UTSW	9	20,683,516 (GRCm39)	missense	unknown
R1668:Col5a3	UTSW	9	20,682,392 (GRCm39)	missense	unknown
R1680:Col5a3	UTSW	9	20,695,964 (GRCm39)	critical splice donor site	probably null
R2112:Col5a3	UTSW	9	20,721,073 (GRCm39)	missense	unknown
R2149:Col5a3	UTSW	9	20,682,566 (GRCm39)	missense	unknown
R2159:Col5a3	UTSW	9	20,682,606 (GRCm39)	missense	unknown
R2939:Col5a3	UTSW	9	20,706,954 (GRCm39)	missense	unknown
R3236:Col5a3	UTSW	9	20,718,949 (GRCm39)	missense	unknown
R3845:Col5a3	UTSW	9	20,719,673 (GRCm39)	missense	unknown
R4598:Col5a3	UTSW	9	20,685,855 (GRCm39)	critical splice donor site	probably null
R4599:Col5a3	UTSW	9	20,685,855 (GRCm39)	critical splice donor site	probably null
R4611:Col5a3	UTSW	9	20,726,192 (GRCm39)	unclassified	probably benign
R4713:Col5a3	UTSW	9	20,704,870 (GRCm39)	missense	unknown
R4723:Col5a3	UTSW	9	20,720,887 (GRCm39)	missense	unknown
R5209:Col5a3	UTSW	9	20,689,939 (GRCm39)	intron	probably benign
R5336:Col5a3	UTSW	9	20,710,597 (GRCm39)	missense	unknown
R5378:Col5a3	UTSW	9	20,708,872 (GRCm39)	missense	unknown
R5614:Col5a3	UTSW	9	20,694,772 (GRCm39)	splice site	probably benign
R5775:Col5a3	UTSW	9	20,712,368 (GRCm39)	missense	unknown
R5895:Col5a3	UTSW	9	20,683,738 (GRCm39)	missense	unknown
R6048:Col5a3	UTSW	9	20,718,915 (GRCm39)	missense	unknown
R6265:Col5a3	UTSW	9	20,705,060 (GRCm39)	missense	unknown
R6372:Col5a3	UTSW	9	20,696,882 (GRCm39)	missense	probably damaging	0.99
R6520:Col5a3	UTSW	9	20,685,348 (GRCm39)	missense	unknown
R6608:Col5a3	UTSW	9	20,685,315 (GRCm39)	missense	unknown
R6679:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6680:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6696:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6698:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6700:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6708:Col5a3	UTSW	9	20,686,331 (GRCm39)	missense	unknown
R6712:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6714:Col5a3	UTSW	9	20,690,329 (GRCm39)	missense	probably damaging	1.00
R6828:Col5a3	UTSW	9	20,709,748 (GRCm39)	missense	unknown
R7343:Col5a3	UTSW	9	20,705,242 (GRCm39)	critical splice donor site	probably null
R7431:Col5a3	UTSW	9	20,682,131 (GRCm39)	makesense	probably null
R7500:Col5a3	UTSW	9	20,711,585 (GRCm39)	missense	unknown
R7592:Col5a3	UTSW	9	20,708,689 (GRCm39)	missense	unknown
R7671:Col5a3	UTSW	9	20,686,382 (GRCm39)	critical splice acceptor site	probably null
R7957:Col5a3	UTSW	9	20,685,347 (GRCm39)	missense	unknown
R8510:Col5a3	UTSW	9	20,705,028 (GRCm39)	missense	unknown
R8979:Col5a3	UTSW	9	20,686,597 (GRCm39)	missense	unknown
R9050:Col5a3	UTSW	9	20,697,691 (GRCm39)	missense	probably damaging	1.00
R9052:Col5a3	UTSW	9	20,710,733 (GRCm39)	missense	unknown
R9072:Col5a3	UTSW	9	20,682,453 (GRCm39)	missense	unknown
R9341:Col5a3	UTSW	9	20,704,909 (GRCm39)	missense	unknown
R9343:Col5a3	UTSW	9	20,704,909 (GRCm39)	missense	unknown
R9529:Col5a3	UTSW	9	20,685,308 (GRCm39)	critical splice donor site	probably null
R9562:Col5a3	UTSW	9	20,714,429 (GRCm39)	missense	unknown
R9781:Col5a3	UTSW	9	20,721,272 (GRCm39)	missense	unknown
Z1177:Col5a3	UTSW	9	20,686,630 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GAACCAAATAGTGTGCAATGACTC -3'
(R):5'- GAGAATACGTGTGTGCGCAC -3'

Sequencing Primer
(F):5'- AGTGTGCAATGACTCCCCATTATTC -3'
(R):5'- GATTTGGTCACTGACTTCCAGCAAG -3'

Posted On

2018-06-06