Incidental Mutation 'R6558:Drc3'
ID522266
Institutional Source Beutler Lab
Gene Symbol Drc3
Ensembl Gene ENSMUSG00000056598
Gene Namedynein regulatory complex subunit 3
Synonyms4930449E07Rik, Lrrc48, m6Bei
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6558 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location60353329-60394341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60364892 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 102 (I102F)
Ref Sequence ENSEMBL: ENSMUSP00000091691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070805] [ENSMUST00000094140] [ENSMUST00000108722] [ENSMUST00000108723]
Predicted Effect probably damaging
Transcript: ENSMUST00000070805
AA Change: I102F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065525
Gene: ENSMUSG00000056598
AA Change: I102F

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094140
AA Change: I102F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091691
Gene: ENSMUSG00000056598
AA Change: I102F

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108722
AA Change: I102F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104362
Gene: ENSMUSG00000056598
AA Change: I102F

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108723
AA Change: I102F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104363
Gene: ENSMUSG00000056598
AA Change: I102F

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128905
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 20,963,673 V161A probably damaging Het
Anxa3 A G 5: 96,812,939 probably null Het
Cftr T C 6: 18,222,528 I261T probably damaging Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Cog2 T C 8: 124,550,232 L659P probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cxcl2 T C 5: 90,904,365 L71P probably damaging Het
Cxcl5 A G 5: 90,759,818 E83G probably damaging Het
Dpt A G 1: 164,796,811 Y27C unknown Het
Fam83h T C 15: 76,004,453 D345G probably damaging Het
Gm14412 G T 2: 177,314,554 T516K probably damaging Het
Grip1 A G 10: 119,454,383 N7D probably benign Het
Hoxc11 T C 15: 102,954,866 L114P probably damaging Het
Htr7 T C 19: 36,057,240 N5S probably damaging Het
Ifi208 C T 1: 173,683,023 T248I probably damaging Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Map7d1 G A 4: 126,232,909 A798V unknown Het
Mfsd13a T A 19: 46,366,478 N31K probably damaging Het
Myadm T A 7: 3,297,061 I113N probably damaging Het
Myo18a A G 11: 77,850,852 E1509G probably damaging Het
Nalcn C G 14: 123,486,507 R382P probably benign Het
Ogfr C T 2: 180,595,404 P594L possibly damaging Het
Olfr458 T A 6: 42,460,777 M81L probably benign Het
Olfr508 T A 7: 108,630,188 H65Q probably damaging Het
Pkd1l1 C T 11: 8,889,052 M877I probably benign Het
Sec23a A T 12: 59,004,552 S102T probably benign Het
Stoml1 T A 9: 58,256,668 V90E probably damaging Het
Stra8 G A 6: 34,933,040 W111* probably null Het
Timeless T A 10: 128,249,563 V850D probably benign Het
Unc5c A T 3: 141,789,729 D453V probably damaging Het
Xdh T G 17: 73,893,713 T1138P possibly damaging Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Drc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Drc3 APN 11 60364962 missense probably null 0.70
IGL01457:Drc3 APN 11 60358649 utr 5 prime probably benign
IGL02329:Drc3 APN 11 60370578 missense probably damaging 1.00
IGL02576:Drc3 APN 11 60370551 missense probably benign 0.01
IGL02610:Drc3 APN 11 60370593 missense probably benign 0.40
IGL02817:Drc3 APN 11 60384236 missense probably benign 0.16
IGL03380:Drc3 APN 11 60377905 missense probably benign 0.01
R0020:Drc3 UTSW 11 60370545 missense probably damaging 1.00
R1221:Drc3 UTSW 11 60384226 missense probably benign
R1394:Drc3 UTSW 11 60393719 missense possibly damaging 0.94
R1483:Drc3 UTSW 11 60388889 missense probably benign 0.00
R2093:Drc3 UTSW 11 60370484 missense probably damaging 1.00
R2151:Drc3 UTSW 11 60375157 missense probably benign 0.15
R4631:Drc3 UTSW 11 60364908 missense probably benign 0.02
R4796:Drc3 UTSW 11 60363528 missense probably damaging 1.00
R4841:Drc3 UTSW 11 60370535 missense probably benign 0.00
R4842:Drc3 UTSW 11 60370535 missense probably benign 0.00
R5739:Drc3 UTSW 11 60375130 missense possibly damaging 0.89
R5766:Drc3 UTSW 11 60393821 missense probably benign 0.18
R6143:Drc3 UTSW 11 60370580 missense possibly damaging 0.82
R6298:Drc3 UTSW 11 60393770 missense possibly damaging 0.74
R6611:Drc3 UTSW 11 60364947 missense probably damaging 0.99
R6938:Drc3 UTSW 11 60394123 critical splice acceptor site probably null
R7013:Drc3 UTSW 11 60387303 missense probably benign 0.00
R7108:Drc3 UTSW 11 60370554 missense probably benign 0.13
R7640:Drc3 UTSW 11 60388904 missense probably benign
R7713:Drc3 UTSW 11 60370560 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCCATCTAATGCTCCTAGAAC -3'
(R):5'- ACCTCAGACCTTGGCTTTGG -3'

Sequencing Primer
(F):5'- TCTAATGCTCCTAGAACCCCCAAC -3'
(R):5'- AGGCCCTGTGGTATTTGTGAC -3'
Posted On2018-06-06