Incidental Mutation 'R6558:Zkscan6'
ID522268
Institutional Source Beutler Lab
Gene Symbol Zkscan6
Ensembl Gene ENSMUSG00000018347
Gene Namezinc finger with KRAB and SCAN domains 6
Synonyms1700128E15Rik, Zfp535, KOX11, D11Ertd714e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R6558 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location65807175-65829239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65828225 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 357 (H357L)
Ref Sequence ENSEMBL: ENSMUSP00000071406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018491] [ENSMUST00000071465] [ENSMUST00000080665]
Predicted Effect probably benign
Transcript: ENSMUST00000018491
AA Change: H357L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018491
Gene: ENSMUSG00000018347
AA Change: H357L

DomainStartEndE-ValueType
SCAN 37 149 2.75e-57 SMART
KRAB 223 280 4.18e-3 SMART
ZnF_C2H2 415 437 1.08e-1 SMART
ZnF_C2H2 443 465 4.72e-2 SMART
ZnF_C2H2 471 493 1.67e-2 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071465
AA Change: H357L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071406
Gene: ENSMUSG00000018347
AA Change: H357L

DomainStartEndE-ValueType
SCAN 37 149 2.75e-57 SMART
KRAB 223 280 4.18e-3 SMART
ZnF_C2H2 415 437 1.08e-1 SMART
ZnF_C2H2 443 465 4.72e-2 SMART
ZnF_C2H2 471 493 1.67e-2 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080665
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152386
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752

DomainStartEndE-ValueType
Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Meta Mutation Damage Score 0.1464 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 20,963,673 V161A probably damaging Het
Anxa3 A G 5: 96,812,939 probably null Het
Cftr T C 6: 18,222,528 I261T probably damaging Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Cog2 T C 8: 124,550,232 L659P probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cxcl2 T C 5: 90,904,365 L71P probably damaging Het
Cxcl5 A G 5: 90,759,818 E83G probably damaging Het
Dpt A G 1: 164,796,811 Y27C unknown Het
Drc3 A T 11: 60,364,892 I102F probably damaging Het
Fam83h T C 15: 76,004,453 D345G probably damaging Het
Gm14412 G T 2: 177,314,554 T516K probably damaging Het
Grip1 A G 10: 119,454,383 N7D probably benign Het
Hoxc11 T C 15: 102,954,866 L114P probably damaging Het
Htr7 T C 19: 36,057,240 N5S probably damaging Het
Ifi208 C T 1: 173,683,023 T248I probably damaging Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Map7d1 G A 4: 126,232,909 A798V unknown Het
Mfsd13a T A 19: 46,366,478 N31K probably damaging Het
Myadm T A 7: 3,297,061 I113N probably damaging Het
Myo18a A G 11: 77,850,852 E1509G probably damaging Het
Nalcn C G 14: 123,486,507 R382P probably benign Het
Ogfr C T 2: 180,595,404 P594L possibly damaging Het
Olfr458 T A 6: 42,460,777 M81L probably benign Het
Olfr508 T A 7: 108,630,188 H65Q probably damaging Het
Pkd1l1 C T 11: 8,889,052 M877I probably benign Het
Sec23a A T 12: 59,004,552 S102T probably benign Het
Stoml1 T A 9: 58,256,668 V90E probably damaging Het
Stra8 G A 6: 34,933,040 W111* probably null Het
Timeless T A 10: 128,249,563 V850D probably benign Het
Unc5c A T 3: 141,789,729 D453V probably damaging Het
Xdh T G 17: 73,893,713 T1138P possibly damaging Het
Other mutations in Zkscan6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zkscan6 APN 11 65828461 missense possibly damaging 0.96
IGL00941:Zkscan6 APN 11 65814747 missense probably damaging 1.00
IGL01784:Zkscan6 APN 11 65814721 missense probably damaging 1.00
IGL02423:Zkscan6 APN 11 65828294 missense probably benign 0.00
IGL03001:Zkscan6 APN 11 65814669 missense probably damaging 1.00
R0105:Zkscan6 UTSW 11 65821985 missense probably damaging 1.00
R0105:Zkscan6 UTSW 11 65821985 missense probably damaging 1.00
R0112:Zkscan6 UTSW 11 65814863 splice site probably benign
R0542:Zkscan6 UTSW 11 65828699 missense possibly damaging 0.92
R1636:Zkscan6 UTSW 11 65814430 start gained probably benign
R2235:Zkscan6 UTSW 11 65828272 missense probably benign 0.00
R3926:Zkscan6 UTSW 11 65828225 missense probably benign
R6083:Zkscan6 UTSW 11 65815931 missense probably damaging 1.00
R6277:Zkscan6 UTSW 11 65828157 missense probably benign 0.00
R6733:Zkscan6 UTSW 11 65828635 missense probably damaging 0.99
R7301:Zkscan6 UTSW 11 65828225 missense probably benign
R7432:Zkscan6 UTSW 11 65814363 critical splice acceptor site probably null
R7466:Zkscan6 UTSW 11 65828531 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGATAACAGGGCATAGCAGTTACTG -3'
(R):5'- TCCCACACTCTCTGCAAGTG -3'

Sequencing Primer
(F):5'- CTTTTTCCTTTCAGAAGACAGACAAG -3'
(R):5'- CAAGTGGGCAGTTTCTGGGC -3'
Posted On2018-06-06