Mutagenetix > Incidental Mutations

Incidental Mutation 'R6564:Abca12'

522288

Institutional Source

Beutler Lab

Gene Symbol

Abca12

Ensembl Gene

ENSMUSG00000050296

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 12

Synonyms

4833417A11Rik, 4832428G11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6564 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71242276-71414910 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71309850 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 834 (E834V)

Ref Sequence

ENSEMBL: ENSMUSP00000084523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087268]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087268
AA Change: E834V

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: E834V

Domain	Start	End	E-Value	Type
transmembrane domain	24	43	N/A	INTRINSIC
low complexity region	246	259	N/A	INTRINSIC
Pfam:ABC2_membrane_3	885	1267	2.9e-24	PFAM
AAA	1370	1554	4.2e-10	SMART
low complexity region	1717	1735	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1744	2206	9.6e-35	PFAM
AAA	2282	2467	4.61e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188752

Meta Mutation Damage Score

0.1118

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,486,077		probably null	Het
4931429L15Rik	C	A	9: 46,306,904	D179Y	probably damaging	Het
Abca1	A	T	4: 53,034,031	L2233Q	possibly damaging	Het
Abcc9	T	C	6: 142,603,108	Y1318C	probably damaging	Het
Adam15	C	A	3: 89,347,212	R121L	possibly damaging	Het
Afdn	T	A	17: 13,896,089	M1588K	probably benign	Het
Akap9	T	C	5: 4,028,491	S1849P	probably damaging	Het
Bag6	T	C	17: 35,140,371	S213P	probably damaging	Het
Bpifb9a	T	C	2: 154,260,178	V65A	probably benign	Het
Chn1	T	A	2: 73,618,041	I203F	probably damaging	Het
Crnkl1	T	A	2: 145,928,245	E226V	possibly damaging	Het
Cspg4	A	G	9: 56,890,158	E1302G	probably benign	Het
Dnah5	G	T	15: 28,367,745	A2759S	probably benign	Het
Doxl2	T	C	6: 48,977,575	V549A	probably benign	Het
Dtx1	T	A	5: 120,695,017	T119S	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ezr	C	T	17: 6,742,847	V268M	probably damaging	Het
Fbxl15	T	C	19: 46,329,338	V153A	probably damaging	Het
Fkbpl	C	A	17: 34,646,266	A336E	probably benign	Het
Gsg1l2	A	G	11: 67,786,504	T200A	possibly damaging	Het
H2afx	T	C	9: 44,334,912	Y51H	probably damaging	Het
Ifi213	A	C	1: 173,595,296	M1R	probably null	Het
Kcnt1	A	C	2: 25,911,051	D1045A	probably benign	Het
Kdm4a	C	A	4: 118,177,439	A32S	probably benign	Het
Klkb1	A	T	8: 45,273,634	V444E	probably damaging	Het
Mccc1	T	C	3: 35,976,676	T414A	probably damaging	Het
Miga1	A	C	3: 152,285,322	N367K	probably damaging	Het
Mmp7	A	G	9: 7,695,184	D49G	probably benign	Het
Nlrp1a	A	G	11: 71,123,572	L284P	probably damaging	Het
Olfr1411	T	C	1: 92,596,563	S15P	probably benign	Het
Olfr853	G	A	9: 19,537,210	T240I	possibly damaging	Het
Pbld1	T	A	10: 63,072,027	I224N	possibly damaging	Het
Pih1d1	A	T	7: 45,159,819	R276W	probably damaging	Het
Plekhg1	G	T	10: 3,964,153	V1292L	probably damaging	Het
Prex2	A	G	1: 11,101,061		probably null	Het
Rbm6	T	C	9: 107,833,498	Y498C	probably damaging	Het
Reps1	T	A	10: 18,122,392		probably null	Het
Ruvbl1	T	A	6: 88,479,226	I154N	possibly damaging	Het
Slc4a5	T	G	6: 83,280,060	F616V	possibly damaging	Het
Spag5	A	T	11: 78,315,575	T798S	probably damaging	Het
Spam1	T	A	6: 24,796,356	I102K	possibly damaging	Het
Sptbn2	C	A	19: 4,732,024	F430L	probably damaging	Het
Svs3a	T	A	2: 164,289,350	I21K	probably damaging	Het
Tet3	T	A	6: 83,386,070	I842L	possibly damaging	Het
Tlr2	T	A	3: 83,837,695	K360N	probably benign	Het
Tmem45b	C	G	9: 31,428,005	W138S	probably damaging	Het
Tpgs2	T	C	18: 25,158,287	E40G	probably damaging	Het
Traj40	T	C	14: 54,177,942		probably benign	Het
Trpm5	A	G	7: 143,072,770	S125P	probably damaging	Het
Ttc3	G	T	16: 94,442,611	C1158F	probably damaging	Het
Tubg1	T	C	11: 101,120,889	I74T	probably damaging	Het
Vav2	A	T	2: 27,279,185		probably null	Het
Wbp4	G	T	14: 79,467,428	H201N	probably damaging	Het
Wdhd1	A	G	14: 47,248,042	S821P	probably benign	Het
Wsb2	A	T	5: 117,370,560		probably null	Het
Zic5	A	G	14: 122,459,421	L594P	unknown	Het

Other mutations in Abca12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Abca12	APN	1	71303541	missense	possibly damaging	0.64
IGL00556:Abca12	APN	1	71353757	missense	probably benign	0.00
IGL00813:Abca12	APN	1	71353762	critical splice acceptor site	probably null
IGL00835:Abca12	APN	1	71302733	missense	probably damaging	1.00
IGL00921:Abca12	APN	1	71285729	missense	probably damaging	1.00
IGL01011:Abca12	APN	1	71263632	missense	probably benign	0.02
IGL01066:Abca12	APN	1	71353730	missense	possibly damaging	0.95
IGL01082:Abca12	APN	1	71314114	missense	probably damaging	1.00
IGL01310:Abca12	APN	1	71284156	missense	probably benign	0.00
IGL01360:Abca12	APN	1	71286489	missense	possibly damaging	0.95
IGL01585:Abca12	APN	1	71319886	missense	probably benign	0.00
IGL01608:Abca12	APN	1	71259442	missense	probably damaging	1.00
IGL01687:Abca12	APN	1	71267610	splice site	probably benign
IGL01700:Abca12	APN	1	71280390	missense	probably benign
IGL01723:Abca12	APN	1	71314168	missense	probably benign	0.01
IGL01804:Abca12	APN	1	71276183	missense	probably benign	0.01
IGL01982:Abca12	APN	1	71346698	missense	probably benign	0.34
IGL02136:Abca12	APN	1	71247142	missense	probably damaging	1.00
IGL02172:Abca12	APN	1	71302658	missense	probably benign	0.09
IGL02222:Abca12	APN	1	71282886	missense	probably benign	0.40
IGL02266:Abca12	APN	1	71268201	nonsense	probably null
IGL02449:Abca12	APN	1	71401749	splice site	probably null
IGL02471:Abca12	APN	1	71258198	missense	probably benign	0.00
IGL02496:Abca12	APN	1	71288553	missense	possibly damaging	0.55
IGL02552:Abca12	APN	1	71294747	missense	probably damaging	0.96
IGL02795:Abca12	APN	1	71288748	missense	probably damaging	1.00
IGL03000:Abca12	APN	1	71321800	missense	probably benign	0.01
IGL03031:Abca12	APN	1	71314024	missense	probably benign	0.00
IGL03131:Abca12	APN	1	71346702	missense	probably benign
IGL03260:Abca12	APN	1	71284099	missense	probably damaging	1.00
IGL03324:Abca12	APN	1	71314008	missense	probably benign
IGL03408:Abca12	APN	1	71264795	missense	probably damaging	1.00
R0016:Abca12	UTSW	1	71294800	missense	probably benign	0.35
R0016:Abca12	UTSW	1	71294800	missense	probably benign	0.35
R0121:Abca12	UTSW	1	71259786	splice site	probably null
R0172:Abca12	UTSW	1	71279402	missense	probably damaging	0.99
R0196:Abca12	UTSW	1	71259813	missense	possibly damaging	0.81
R0400:Abca12	UTSW	1	71259776	splice site	probably benign
R0466:Abca12	UTSW	1	71302663	missense	probably damaging	1.00
R0616:Abca12	UTSW	1	71302671	missense	probably damaging	1.00
R0668:Abca12	UTSW	1	71263614	missense	probably damaging	1.00
R0928:Abca12	UTSW	1	71349174	missense	probably benign	0.06
R1036:Abca12	UTSW	1	71263410	critical splice donor site	probably null
R1086:Abca12	UTSW	1	71295061	splice site	probably benign
R1300:Abca12	UTSW	1	71244808	missense	probably damaging	1.00
R1337:Abca12	UTSW	1	71294819	missense	probably benign	0.03
R1356:Abca12	UTSW	1	71302953	splice site	probably benign
R1372:Abca12	UTSW	1	71294857	missense	probably damaging	1.00
R1434:Abca12	UTSW	1	71309800	missense	probably benign	0.00
R1580:Abca12	UTSW	1	71265965	missense	possibly damaging	0.65
R1675:Abca12	UTSW	1	71263411	critical splice donor site	probably null
R1773:Abca12	UTSW	1	71288596	missense	probably damaging	1.00
R1829:Abca12	UTSW	1	71295029	missense	probably benign	0.26
R1922:Abca12	UTSW	1	71319924	missense	probably benign	0.10
R1927:Abca12	UTSW	1	71244840	missense	probably damaging	1.00
R2115:Abca12	UTSW	1	71244771	missense	probably benign	0.01
R2146:Abca12	UTSW	1	71263488	missense	probably benign	0.02
R2148:Abca12	UTSW	1	71263488	missense	probably benign	0.02
R2149:Abca12	UTSW	1	71263488	missense	probably benign	0.02
R2150:Abca12	UTSW	1	71263488	missense	probably benign	0.02
R2299:Abca12	UTSW	1	71258222	missense	probably damaging	1.00
R2392:Abca12	UTSW	1	71258105	missense	probably damaging	1.00
R2571:Abca12	UTSW	1	71249885	missense	probably benign	0.00
R3077:Abca12	UTSW	1	71267605	missense	probably benign	0.02
R3078:Abca12	UTSW	1	71267605	missense	probably benign	0.02
R3705:Abca12	UTSW	1	71285705	missense	probably damaging	1.00
R3800:Abca12	UTSW	1	71265887	missense	probably damaging	1.00
R3905:Abca12	UTSW	1	71268230	missense	possibly damaging	0.79
R3905:Abca12	UTSW	1	71279457	missense	probably benign	0.02
R3962:Abca12	UTSW	1	71274515	splice site	probably null
R4082:Abca12	UTSW	1	71267463	missense	possibly damaging	0.64
R4131:Abca12	UTSW	1	71319871	critical splice donor site	probably null
R4214:Abca12	UTSW	1	71288697	missense	probably damaging	0.99
R4403:Abca12	UTSW	1	71267436	missense	probably damaging	1.00
R4524:Abca12	UTSW	1	71302917	missense	probably benign	0.19
R4615:Abca12	UTSW	1	71330334	missense	probably benign
R4617:Abca12	UTSW	1	71330334	missense	probably benign
R4714:Abca12	UTSW	1	71321450	missense	probably benign	0.00
R4809:Abca12	UTSW	1	71278856	missense	probably benign	0.10
R4810:Abca12	UTSW	1	71303612	missense	probably benign	0.00
R4825:Abca12	UTSW	1	71302685	missense	possibly damaging	0.70
R4990:Abca12	UTSW	1	71294939	missense	possibly damaging	0.61
R5013:Abca12	UTSW	1	71264767	missense	probably damaging	0.99
R5026:Abca12	UTSW	1	71317224	missense	probably benign	0.04
R5064:Abca12	UTSW	1	71300960	missense	probably damaging	1.00
R5188:Abca12	UTSW	1	71291492	missense	probably benign	0.23
R5234:Abca12	UTSW	1	71263664	missense	probably damaging	0.99
R5267:Abca12	UTSW	1	71335774	splice site	probably benign
R5302:Abca12	UTSW	1	71283952	missense	possibly damaging	0.91
R5441:Abca12	UTSW	1	71295056	missense	probably damaging	1.00
R5451:Abca12	UTSW	1	71294917	missense	possibly damaging	0.94
R5526:Abca12	UTSW	1	71292446	missense	probably benign	0.29
R5529:Abca12	UTSW	1	71264881	missense	probably damaging	1.00
R5615:Abca12	UTSW	1	71307059	missense	probably damaging	1.00
R5649:Abca12	UTSW	1	71291342	missense	probably damaging	1.00
R5800:Abca12	UTSW	1	71321432	missense	possibly damaging	0.78
R5807:Abca12	UTSW	1	71303492	missense	probably damaging	1.00
R5878:Abca12	UTSW	1	71346633	missense	possibly damaging	0.79
R5987:Abca12	UTSW	1	71258098	missense	probably damaging	1.00
R6280:Abca12	UTSW	1	71272460	missense	probably benign	0.04
R6316:Abca12	UTSW	1	71313959	missense	probably benign	0.01
R6337:Abca12	UTSW	1	71295013	missense	probably damaging	1.00
R6383:Abca12	UTSW	1	71247184	missense	probably benign	0.03
R6582:Abca12	UTSW	1	71258225	missense	probably benign	0.00
R6756:Abca12	UTSW	1	71259353	splice site	probably null
R6876:Abca12	UTSW	1	71263508	missense	probably damaging	0.98
R6999:Abca12	UTSW	1	71317162	nonsense	probably null
R7145:Abca12	UTSW	1	71307053	missense	possibly damaging	0.92
R7272:Abca12	UTSW	1	71248432	missense	probably damaging	0.99
R7285:Abca12	UTSW	1	71349155	nonsense	probably null
R7421:Abca12	UTSW	1	71247136	nonsense	probably null
R7531:Abca12	UTSW	1	71247173	missense	probably damaging	0.99
R7592:Abca12	UTSW	1	71288677	missense	probably benign	0.01
R7687:Abca12	UTSW	1	71258182	missense	probably benign	0.00
R7690:Abca12	UTSW	1	71314154	missense	probably benign	0.00
R7709:Abca12	UTSW	1	71335728	missense	probably benign	0.00
R7736:Abca12	UTSW	1	71319964	missense	probably benign	0.01
R7754:Abca12	UTSW	1	71302887	missense	probably benign
R7761:Abca12	UTSW	1	71330288	missense	probably damaging	1.00
R7808:Abca12	UTSW	1	71274634	splice site	probably null
R7816:Abca12	UTSW	1	71292429	missense	probably benign	0.01
R7821:Abca12	UTSW	1	71259791	missense	probably benign	0.12
R7827:Abca12	UTSW	1	71414678	start gained	probably benign
R7829:Abca12	UTSW	1	71292421	missense	probably benign	0.37
R7863:Abca12	UTSW	1	71293497	missense	probably damaging	0.96
R8053:Abca12	UTSW	1	71349169	nonsense	probably null
R8093:Abca12	UTSW	1	71280393	missense	probably benign	0.00
R8120:Abca12	UTSW	1	71259381	missense	possibly damaging	0.92
R8136:Abca12	UTSW	1	71248397	missense	probably benign	0.15
R8155:Abca12	UTSW	1	71291338	missense	probably damaging	1.00
R8189:Abca12	UTSW	1	71285726	missense	probably damaging	1.00
R8233:Abca12	UTSW	1	71351757	missense	probably benign	0.00
R8249:Abca12	UTSW	1	71321812	missense	probably benign	0.00
R8255:Abca12	UTSW	1	71319899	missense	probably benign	0.13
R8300:Abca12	UTSW	1	71313964	missense	possibly damaging	0.77
R8339:Abca12	UTSW	1	71285672	missense	probably damaging	1.00
R8490:Abca12	UTSW	1	71284097	missense	probably damaging	1.00
R8494:Abca12	UTSW	1	71288662	missense	probably benign	0.02
R8527:Abca12	UTSW	1	71309888	critical splice acceptor site	probably null
R8542:Abca12	UTSW	1	71309888	critical splice acceptor site	probably null
X0013:Abca12	UTSW	1	71248433	missense	probably damaging	0.99
X0018:Abca12	UTSW	1	71314510	missense	probably benign
X0063:Abca12	UTSW	1	71349064	missense	probably benign	0.15
X0065:Abca12	UTSW	1	71341461	critical splice donor site	probably null
Z1176:Abca12	UTSW	1	71284070	missense	probably damaging	1.00
Z1177:Abca12	UTSW	1	71276082	missense	possibly damaging	0.94
Z1177:Abca12	UTSW	1	71282811	missense	probably damaging	0.98
Z1177:Abca12	UTSW	1	71292531	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTCTCAGACCCTATCTCTGGAGAG -3'
(R):5'- GATCTTGGTCCTTACAAGATGTATC -3'

Sequencing Primer
(F):5'- CTATCTCTGGAGAGGAGGTTATTC -3'
(R):5'- TGGTCCTTACAAGATGTATCATTTG -3'

Posted On

2018-06-06