Incidental Mutation 'R6564:Olfr1411'
ID522290
Institutional Source Beutler Lab
Gene Symbol Olfr1411
Ensembl Gene ENSMUSG00000062497
Gene Nameolfactory receptor 1411
SynonymsGA_x6K02T2R7CC-81157497-81156526, MOR208-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6564 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location92594411-92597753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92596563 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 15 (S15P)
Ref Sequence ENSEMBL: ENSMUSP00000150254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073748] [ENSMUST00000190844] [ENSMUST00000216444]
Predicted Effect probably benign
Transcript: ENSMUST00000073748
AA Change: S15P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073422
Gene: ENSMUSG00000062497
AA Change: S15P

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:7tm_4 38 314 7.4e-53 PFAM
Pfam:7tm_1 48 297 1.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190844
AA Change: S15P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140373
Gene: ENSMUSG00000062497
AA Change: S15P

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 32 44 N/A INTRINSIC
Pfam:7tm_1 48 297 6.7e-25 PFAM
Pfam:7tm_4 146 290 2.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203299
Predicted Effect probably benign
Transcript: ENSMUST00000216444
AA Change: S15P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,486,077 probably null Het
4931429L15Rik C A 9: 46,306,904 D179Y probably damaging Het
Abca1 A T 4: 53,034,031 L2233Q possibly damaging Het
Abca12 T A 1: 71,309,850 E834V possibly damaging Het
Abcc9 T C 6: 142,603,108 Y1318C probably damaging Het
Adam15 C A 3: 89,347,212 R121L possibly damaging Het
Afdn T A 17: 13,896,089 M1588K probably benign Het
Akap9 T C 5: 4,028,491 S1849P probably damaging Het
Bag6 T C 17: 35,140,371 S213P probably damaging Het
Bpifb9a T C 2: 154,260,178 V65A probably benign Het
Chn1 T A 2: 73,618,041 I203F probably damaging Het
Crnkl1 T A 2: 145,928,245 E226V possibly damaging Het
Cspg4 A G 9: 56,890,158 E1302G probably benign Het
Dnah5 G T 15: 28,367,745 A2759S probably benign Het
Doxl2 T C 6: 48,977,575 V549A probably benign Het
Dtx1 T A 5: 120,695,017 T119S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ezr C T 17: 6,742,847 V268M probably damaging Het
Fbxl15 T C 19: 46,329,338 V153A probably damaging Het
Fkbpl C A 17: 34,646,266 A336E probably benign Het
Gsg1l2 A G 11: 67,786,504 T200A possibly damaging Het
H2afx T C 9: 44,334,912 Y51H probably damaging Het
Ifi213 A C 1: 173,595,296 M1R probably null Het
Kcnt1 A C 2: 25,911,051 D1045A probably benign Het
Kdm4a C A 4: 118,177,439 A32S probably benign Het
Klkb1 A T 8: 45,273,634 V444E probably damaging Het
Mccc1 T C 3: 35,976,676 T414A probably damaging Het
Miga1 A C 3: 152,285,322 N367K probably damaging Het
Mmp7 A G 9: 7,695,184 D49G probably benign Het
Nlrp1a A G 11: 71,123,572 L284P probably damaging Het
Olfr853 G A 9: 19,537,210 T240I possibly damaging Het
Pbld1 T A 10: 63,072,027 I224N possibly damaging Het
Pih1d1 A T 7: 45,159,819 R276W probably damaging Het
Plekhg1 G T 10: 3,964,153 V1292L probably damaging Het
Prex2 A G 1: 11,101,061 probably null Het
Rbm6 T C 9: 107,833,498 Y498C probably damaging Het
Reps1 T A 10: 18,122,392 probably null Het
Ruvbl1 T A 6: 88,479,226 I154N possibly damaging Het
Slc4a5 T G 6: 83,280,060 F616V possibly damaging Het
Spag5 A T 11: 78,315,575 T798S probably damaging Het
Spam1 T A 6: 24,796,356 I102K possibly damaging Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svs3a T A 2: 164,289,350 I21K probably damaging Het
Tet3 T A 6: 83,386,070 I842L possibly damaging Het
Tlr2 T A 3: 83,837,695 K360N probably benign Het
Tmem45b C G 9: 31,428,005 W138S probably damaging Het
Tpgs2 T C 18: 25,158,287 E40G probably damaging Het
Traj40 T C 14: 54,177,942 probably benign Het
Trpm5 A G 7: 143,072,770 S125P probably damaging Het
Ttc3 G T 16: 94,442,611 C1158F probably damaging Het
Tubg1 T C 11: 101,120,889 I74T probably damaging Het
Vav2 A T 2: 27,279,185 probably null Het
Wbp4 G T 14: 79,467,428 H201N probably damaging Het
Wdhd1 A G 14: 47,248,042 S821P probably benign Het
Wsb2 A T 5: 117,370,560 probably null Het
Zic5 A G 14: 122,459,421 L594P unknown Het
Other mutations in Olfr1411
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Olfr1411 APN 1 92597200 missense possibly damaging 0.46
IGL02011:Olfr1411 APN 1 92596899 missense probably damaging 1.00
PIT4810001:Olfr1411 UTSW 1 92597154 missense probably benign 0.04
R2036:Olfr1411 UTSW 1 92596606 missense probably benign 0.19
R2044:Olfr1411 UTSW 1 92596969 missense probably benign 0.00
R4133:Olfr1411 UTSW 1 92596743 missense probably benign 0.09
R4406:Olfr1411 UTSW 1 92597314 missense possibly damaging 0.90
R4568:Olfr1411 UTSW 1 92597391 missense probably benign 0.09
R4701:Olfr1411 UTSW 1 92597438 missense probably benign 0.00
R4801:Olfr1411 UTSW 1 92596998 missense probably benign 0.01
R4802:Olfr1411 UTSW 1 92596998 missense probably benign 0.01
R7082:Olfr1411 UTSW 1 92596418 start gained probably benign
R7349:Olfr1411 UTSW 1 92597182 missense possibly damaging 0.95
R7589:Olfr1411 UTSW 1 92597059 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATCTGGTGAACTTTTGCAC -3'
(R):5'- GAAGTTGGCCAGGGCATTAG -3'

Sequencing Primer
(F):5'- GAACTTTTGCACAGTGGCAC -3'
(R):5'- TCGACAAAGGACAGGTTCTTG -3'
Posted On2018-06-06