Incidental Mutation 'R6530:Ttc33'
ID522293
Institutional Source Beutler Lab
Gene Symbol Ttc33
Ensembl Gene ENSMUSG00000022151
Gene Nametetratricopeptide repeat domain 33
Synonyms2900001O04Rik, 2410099M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6530 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location5185525-5218336 bp(+) (GRCm38)
Type of Mutationunclassified (79 bp from exon)
DNA Base Change (assembly) A to G at 5212122 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022751] [ENSMUST00000081640] [ENSMUST00000118193] [ENSMUST00000141167] [ENSMUST00000144653]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022751
AA Change: I143V

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022751
Gene: ENSMUSG00000022151
AA Change: I143V

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:TPR_11 57 124 2e-13 PFAM
Pfam:TPR_2 61 92 1.4e-5 PFAM
Pfam:TPR_1 127 160 8.7e-4 PFAM
Pfam:TPR_2 127 160 6.7e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081640
SMART Domains Protein: ENSMUSP00000080345
Gene: ENSMUSG00000022151

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118193
AA Change: I143V

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114033
Gene: ENSMUSG00000022151
AA Change: I143V

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:TPR_11 57 124 7.6e-13 PFAM
Pfam:TPR_2 61 92 1.4e-5 PFAM
Pfam:TPR_2 127 160 6.6e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133966
Predicted Effect probably null
Transcript: ENSMUST00000141167
SMART Domains Protein: ENSMUSP00000121937
Gene: ENSMUSG00000022151

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:TPR_11 57 116 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144653
AA Change: I143V

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122250
Gene: ENSMUSG00000022151
AA Change: I143V

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:TPR_9 55 103 3.2e-2 PFAM
Pfam:TPR_11 57 124 1.5e-13 PFAM
Pfam:TPR_2 60 92 1.3e-5 PFAM
Pfam:TPR_9 101 163 1.4e-3 PFAM
Pfam:TPR_1 127 160 7.9e-4 PFAM
Pfam:TPR_2 127 160 6.3e-4 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,588,695 L74P possibly damaging Het
Adamtsl4 T C 3: 95,681,054 T575A probably benign Het
Adck5 T G 15: 76,593,847 D224E probably benign Het
Asic4 A G 1: 75,472,335 N376S probably damaging Het
Atl3 T A 19: 7,522,134 D254E probably benign Het
Cacnb2 G T 2: 14,975,167 A274S probably damaging Het
Car2 T C 3: 14,896,731 V159A probably benign Het
Ccdc138 G C 10: 58,544,968 G474R probably damaging Het
Coq7 T C 7: 118,525,335 T203A probably benign Het
Dnah12 T C 14: 26,735,710 I877T probably damaging Het
Dnah7a C T 1: 53,503,697 R2438H probably benign Het
Efhc1 T A 1: 20,961,142 probably null Het
Fbn1 G A 2: 125,389,270 R459C probably damaging Het
Fer1l4 A G 2: 156,047,865 probably null Het
Gm38394 A G 1: 133,659,201 S133P probably damaging Het
Gm5114 G A 7: 39,408,090 P702S probably damaging Het
Gm9047 G A 6: 29,471,951 probably null Het
Inpp5f T A 7: 128,664,078 Y182* probably null Het
Irf6 C T 1: 193,157,349 T44M probably damaging Het
Loxhd1 A G 18: 77,412,151 N87S probably benign Het
Mtrf1 A T 14: 79,402,891 Q162L possibly damaging Het
Myoz3 G T 18: 60,579,520 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Olfr1065 A C 2: 86,445,482 S167A probably benign Het
Parg T C 14: 32,209,199 S176P probably damaging Het
Prdm2 A C 4: 143,134,047 V891G probably benign Het
Rasl10a T A 11: 5,058,367 I21N probably damaging Het
Reg4 T C 3: 98,224,832 V20A probably benign Het
Shprh T A 10: 11,194,267 S1462R probably benign Het
Sult1e1 T C 5: 87,576,288 E270G probably benign Het
Trpm7 A C 2: 126,812,711 F1436V probably damaging Het
Ucp2 A T 7: 100,498,223 E161D probably benign Het
Vmn2r79 T C 7: 87,002,044 F217S possibly damaging Het
Wdr93 G A 7: 79,755,993 A207T probably damaging Het
Zfp949 T C 9: 88,567,287 probably null Het
Other mutations in Ttc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Ttc33 APN 15 5217328 missense probably damaging 1.00
IGL03240:Ttc33 APN 15 5217328 missense probably damaging 1.00
R1603:Ttc33 UTSW 15 5189794 missense probably damaging 1.00
R1750:Ttc33 UTSW 15 5212098 nonsense probably null
R2115:Ttc33 UTSW 15 5212053 missense probably benign 0.04
R2209:Ttc33 UTSW 15 5208443 missense possibly damaging 0.47
R6971:Ttc33 UTSW 15 5212042 missense probably damaging 1.00
R7120:Ttc33 UTSW 15 5212007 missense probably benign 0.00
R7264:Ttc33 UTSW 15 5217237 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCATGGAAATGCTGTGTGAC -3'
(R):5'- TCTAAGGCAACAAAGTGCAGTAAC -3'

Sequencing Primer
(F):5'- GATTACCAACCAGTAGTTTGTCAG -3'
(R):5'- TGCAGTAACAGGGTGGGGTAC -3'
Posted On2018-06-06