Incidental Mutation 'R6531:Sf3b1'
ID522305
Institutional Source Beutler Lab
Gene Symbol Sf3b1
Ensembl Gene ENSMUSG00000025982
Gene Namesplicing factor 3b, subunit 1
SynonymsTarg4, SAP155, Prp10, 2810001M05Rik, SF3b155
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6531 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location54985169-55027481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55019395 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 12 (E12K)
Ref Sequence ENSEMBL: ENSMUSP00000139469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027127] [ENSMUST00000191303]
Predicted Effect probably benign
Transcript: ENSMUST00000027127
AA Change: E12K

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: E12K

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
internal_repeat_1 185 276 1.77e-12 PROSPERO
Pfam:SF3b1 329 452 1.2e-51 PFAM
SCOP:d1qbkb_ 489 1289 5e-62 SMART
Blast:ARM 593 637 6e-13 BLAST
Blast:ARM 1005 1044 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189051
Predicted Effect probably damaging
Transcript: ENSMUST00000191303
AA Change: E12K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139469
Gene: ENSMUSG00000025982
AA Change: E12K

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
Meta Mutation Damage Score 0.4530 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Sf3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Sf3b1 APN 1 54987486 missense probably damaging 1.00
IGL00815:Sf3b1 APN 1 54996931 splice site probably benign
IGL01380:Sf3b1 APN 1 54987949 missense probably damaging 1.00
IGL01390:Sf3b1 APN 1 54987429 missense probably benign 0.17
IGL02974:Sf3b1 APN 1 55007707 missense probably benign 0.00
IGL03159:Sf3b1 APN 1 55012213 missense probably benign
Colt UTSW 1 54997156 missense probably benign 0.45
Glock UTSW 1 55001046 missense probably damaging 0.96
Handgun UTSW 1 55007507 missense probably damaging 1.00
Kalashnikov UTSW 1 55019265 missense probably damaging 0.99
Magazine UTSW 1 55012182 nonsense probably null
Revolver UTSW 1 55019389 nonsense probably null
R0053:Sf3b1 UTSW 1 55000373 nonsense probably null
R0053:Sf3b1 UTSW 1 55000373 nonsense probably null
R0190:Sf3b1 UTSW 1 54990306 missense probably damaging 0.99
R0277:Sf3b1 UTSW 1 55019257 missense probably damaging 0.99
R0323:Sf3b1 UTSW 1 55019257 missense probably damaging 0.99
R0369:Sf3b1 UTSW 1 54998108 missense probably benign 0.10
R0396:Sf3b1 UTSW 1 55019271 missense probably damaging 1.00
R0718:Sf3b1 UTSW 1 55019385 missense probably damaging 0.99
R0991:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1082:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1083:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1084:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1196:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1376:Sf3b1 UTSW 1 55019265 missense probably damaging 0.99
R1376:Sf3b1 UTSW 1 55019265 missense probably damaging 0.99
R1381:Sf3b1 UTSW 1 55003154 missense probably damaging 0.99
R1436:Sf3b1 UTSW 1 55001421 missense possibly damaging 0.72
R1559:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1560:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1561:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1567:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1568:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1588:Sf3b1 UTSW 1 54997177 missense probably benign 0.05
R1625:Sf3b1 UTSW 1 55019377 missense probably damaging 1.00
R1694:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1735:Sf3b1 UTSW 1 55000652 missense probably damaging 1.00
R1900:Sf3b1 UTSW 1 54998188 missense possibly damaging 0.75
R2186:Sf3b1 UTSW 1 55007633 missense probably benign
R2429:Sf3b1 UTSW 1 55016801 missense possibly damaging 0.71
R2473:Sf3b1 UTSW 1 54999626 critical splice donor site probably null
R3772:Sf3b1 UTSW 1 54999991 intron probably benign
R3911:Sf3b1 UTSW 1 55019389 nonsense probably null
R3970:Sf3b1 UTSW 1 55012182 nonsense probably null
R4706:Sf3b1 UTSW 1 54990507 missense probably damaging 1.00
R4707:Sf3b1 UTSW 1 54990507 missense probably damaging 1.00
R4964:Sf3b1 UTSW 1 54999712 missense probably benign
R5053:Sf3b1 UTSW 1 54997177 missense probably benign 0.05
R5358:Sf3b1 UTSW 1 55003310 missense probably benign 0.09
R5379:Sf3b1 UTSW 1 55003150 missense possibly damaging 0.94
R5628:Sf3b1 UTSW 1 54998175 missense probably benign 0.27
R5636:Sf3b1 UTSW 1 54997193 missense probably damaging 1.00
R6013:Sf3b1 UTSW 1 55000298 missense probably damaging 0.98
R6149:Sf3b1 UTSW 1 55007507 missense probably damaging 1.00
R6217:Sf3b1 UTSW 1 55007518 missense probably damaging 1.00
R6426:Sf3b1 UTSW 1 54999655 missense probably benign 0.01
R6945:Sf3b1 UTSW 1 54997156 missense probably benign 0.45
R7001:Sf3b1 UTSW 1 55001046 missense probably damaging 0.96
R7001:Sf3b1 UTSW 1 55014481 critical splice donor site probably null
R7302:Sf3b1 UTSW 1 55016790 missense probably benign 0.00
R7644:Sf3b1 UTSW 1 54997143 nonsense probably null
R7664:Sf3b1 UTSW 1 54987467 missense probably damaging 1.00
R7735:Sf3b1 UTSW 1 55003349 missense probably benign 0.29
R7809:Sf3b1 UTSW 1 54995455 missense possibly damaging 0.60
R8516:Sf3b1 UTSW 1 55012103 missense probably null 0.01
Z1177:Sf3b1 UTSW 1 55003402 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTTGCCTCCTAGATAATCTGTAAC -3'
(R):5'- AAAGTAGCTTTAATTTTCCCGTGGG -3'

Sequencing Primer
(F):5'- CTTACATCTTCAAGTTCAGTTGCAG -3'
(R):5'- GAGATAGTAAATCAGCTTTGTGTTCC -3'
Posted On2018-06-06