Incidental Mutation 'R6531:Sf3b1'
ID 522305
Institutional Source Beutler Lab
Gene Symbol Sf3b1
Ensembl Gene ENSMUSG00000025982
Gene Name splicing factor 3b, subunit 1
Synonyms Prp10, SAP155, SF3b155, 2810001M05Rik, Targ4
MMRRC Submission 044657-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6531 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 55024328-55066640 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55058554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 12 (E12K)
Ref Sequence ENSEMBL: ENSMUSP00000139469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027127] [ENSMUST00000191303]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027127
AA Change: E12K

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: E12K

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
internal_repeat_1 185 276 1.77e-12 PROSPERO
Pfam:SF3b1 329 452 1.2e-51 PFAM
SCOP:d1qbkb_ 489 1289 5e-62 SMART
Blast:ARM 593 637 6e-13 BLAST
Blast:ARM 1005 1044 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189051
Predicted Effect probably damaging
Transcript: ENSMUST00000191303
AA Change: E12K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139469
Gene: ENSMUSG00000025982
AA Change: E12K

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
Meta Mutation Damage Score 0.4530 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,926,980 (GRCm39) E880G possibly damaging Het
Acsbg2 T A 17: 57,153,617 (GRCm39) I529F probably damaging Het
Ahcyl2 T G 6: 29,886,161 (GRCm39) M359R probably benign Het
Aldh5a1 G T 13: 25,102,547 (GRCm39) D305E probably benign Het
Catsper2 C G 2: 121,230,261 (GRCm39) V358L possibly damaging Het
Cd200r4 C T 16: 44,653,868 (GRCm39) Q222* probably null Het
Col4a2 T A 8: 11,458,135 (GRCm39) D270E probably benign Het
Cux1 T C 5: 136,303,973 (GRCm39) D1401G probably benign Het
Cyp3a59 T A 5: 146,035,027 (GRCm39) M235K probably benign Het
Dock3 T C 9: 106,844,415 (GRCm39) D895G probably benign Het
Dync1h1 T C 12: 110,584,354 (GRCm39) F586L probably damaging Het
Elmo1 G T 13: 20,756,616 (GRCm39) R568L possibly damaging Het
Epb41 T C 4: 131,684,947 (GRCm39) T711A probably benign Het
Grm7 T A 6: 111,335,386 (GRCm39) M599K probably benign Het
Hivep3 A T 4: 119,980,073 (GRCm39) K1704* probably null Het
Ighv1-62-3 C A 12: 115,424,626 (GRCm39) C115F probably damaging Het
Krt78 A G 15: 101,860,708 (GRCm39) Y200H probably benign Het
Lamb2 A T 9: 108,360,925 (GRCm39) H549L possibly damaging Het
Mroh3 A G 1: 136,112,091 (GRCm39) I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,775,161 (GRCm39) probably null Het
Nol6 G T 4: 41,118,154 (GRCm39) P828T probably benign Het
Or1j15 G A 2: 36,459,353 (GRCm39) V248I probably damaging Het
Or4c3 A G 2: 89,851,801 (GRCm39) V203A probably benign Het
Or5m5 A G 2: 85,814,651 (GRCm39) I156V probably benign Het
Or8w1 A G 2: 87,465,873 (GRCm39) Y73H probably damaging Het
Ovgp1 A C 3: 105,894,387 (GRCm39) probably benign Het
Pitpnm3 T A 11: 71,962,313 (GRCm39) Q230L possibly damaging Het
Pkn1 C T 8: 84,396,922 (GRCm39) V910I probably benign Het
Plcb1 T A 2: 135,167,722 (GRCm39) probably null Het
Ppp1r12c A G 7: 4,485,788 (GRCm39) probably null Het
Rassf5 T A 1: 131,172,551 (GRCm39) Q106L possibly damaging Het
Rfc1 T C 5: 65,470,322 (GRCm39) K62E possibly damaging Het
Slc4a1ap A T 5: 31,705,982 (GRCm39) D691V probably benign Het
Speg T A 1: 75,399,401 (GRCm39) F2283I probably benign Het
Styxl2 A T 1: 165,937,615 (GRCm39) probably null Het
Synj2 A G 17: 6,084,114 (GRCm39) K267E probably damaging Het
Tg A T 15: 66,711,211 (GRCm39) Y991F probably damaging Het
Tlk1 A T 2: 70,572,427 (GRCm39) D380E probably benign Het
Trim43b A T 9: 88,967,418 (GRCm39) L405H probably damaging Het
Ttf2 A G 3: 100,863,576 (GRCm39) I586T probably damaging Het
Ugt2b36 T A 5: 87,229,445 (GRCm39) R213S probably damaging Het
Vmn1r198 T A 13: 22,538,577 (GRCm39) M21K probably benign Het
Wdr35 A T 12: 9,028,685 (GRCm39) Y101F probably benign Het
Zfp367 T C 13: 64,292,064 (GRCm39) Y189C probably damaging Het
Other mutations in Sf3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Sf3b1 APN 1 55,026,645 (GRCm39) missense probably damaging 1.00
IGL00815:Sf3b1 APN 1 55,036,090 (GRCm39) splice site probably benign
IGL01380:Sf3b1 APN 1 55,027,108 (GRCm39) missense probably damaging 1.00
IGL01390:Sf3b1 APN 1 55,026,588 (GRCm39) missense probably benign 0.17
IGL02974:Sf3b1 APN 1 55,046,866 (GRCm39) missense probably benign 0.00
IGL03159:Sf3b1 APN 1 55,051,372 (GRCm39) missense probably benign
Colt UTSW 1 55,036,315 (GRCm39) missense probably benign 0.45
Glock UTSW 1 55,040,205 (GRCm39) missense probably damaging 0.96
Handgun UTSW 1 55,046,666 (GRCm39) missense probably damaging 1.00
Kalashnikov UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
Magazine UTSW 1 55,051,341 (GRCm39) nonsense probably null
Revolver UTSW 1 55,058,548 (GRCm39) nonsense probably null
R0053:Sf3b1 UTSW 1 55,039,532 (GRCm39) nonsense probably null
R0053:Sf3b1 UTSW 1 55,039,532 (GRCm39) nonsense probably null
R0190:Sf3b1 UTSW 1 55,029,465 (GRCm39) missense probably damaging 0.99
R0277:Sf3b1 UTSW 1 55,058,416 (GRCm39) missense probably damaging 0.99
R0323:Sf3b1 UTSW 1 55,058,416 (GRCm39) missense probably damaging 0.99
R0369:Sf3b1 UTSW 1 55,037,267 (GRCm39) missense probably benign 0.10
R0396:Sf3b1 UTSW 1 55,058,430 (GRCm39) missense probably damaging 1.00
R0718:Sf3b1 UTSW 1 55,058,544 (GRCm39) missense probably damaging 0.99
R0991:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1082:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1083:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1084:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1196:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1376:Sf3b1 UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
R1376:Sf3b1 UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
R1381:Sf3b1 UTSW 1 55,042,313 (GRCm39) missense probably damaging 0.99
R1436:Sf3b1 UTSW 1 55,040,580 (GRCm39) missense possibly damaging 0.72
R1559:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1560:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1561:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1567:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1568:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1588:Sf3b1 UTSW 1 55,036,336 (GRCm39) missense probably benign 0.05
R1625:Sf3b1 UTSW 1 55,058,536 (GRCm39) missense probably damaging 1.00
R1694:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1735:Sf3b1 UTSW 1 55,039,811 (GRCm39) missense probably damaging 1.00
R1900:Sf3b1 UTSW 1 55,037,347 (GRCm39) missense possibly damaging 0.75
R2186:Sf3b1 UTSW 1 55,046,792 (GRCm39) missense probably benign
R2429:Sf3b1 UTSW 1 55,055,960 (GRCm39) missense possibly damaging 0.71
R2473:Sf3b1 UTSW 1 55,038,785 (GRCm39) critical splice donor site probably null
R3772:Sf3b1 UTSW 1 55,039,150 (GRCm39) intron probably benign
R3911:Sf3b1 UTSW 1 55,058,548 (GRCm39) nonsense probably null
R3970:Sf3b1 UTSW 1 55,051,341 (GRCm39) nonsense probably null
R4706:Sf3b1 UTSW 1 55,029,666 (GRCm39) missense probably damaging 1.00
R4707:Sf3b1 UTSW 1 55,029,666 (GRCm39) missense probably damaging 1.00
R4964:Sf3b1 UTSW 1 55,038,871 (GRCm39) missense probably benign
R5053:Sf3b1 UTSW 1 55,036,336 (GRCm39) missense probably benign 0.05
R5358:Sf3b1 UTSW 1 55,042,469 (GRCm39) missense probably benign 0.09
R5379:Sf3b1 UTSW 1 55,042,309 (GRCm39) missense possibly damaging 0.94
R5628:Sf3b1 UTSW 1 55,037,334 (GRCm39) missense probably benign 0.27
R5636:Sf3b1 UTSW 1 55,036,352 (GRCm39) missense probably damaging 1.00
R6013:Sf3b1 UTSW 1 55,039,457 (GRCm39) missense probably damaging 0.98
R6149:Sf3b1 UTSW 1 55,046,666 (GRCm39) missense probably damaging 1.00
R6217:Sf3b1 UTSW 1 55,046,677 (GRCm39) missense probably damaging 1.00
R6426:Sf3b1 UTSW 1 55,038,814 (GRCm39) missense probably benign 0.01
R6945:Sf3b1 UTSW 1 55,036,315 (GRCm39) missense probably benign 0.45
R7001:Sf3b1 UTSW 1 55,053,640 (GRCm39) critical splice donor site probably null
R7001:Sf3b1 UTSW 1 55,040,205 (GRCm39) missense probably damaging 0.96
R7302:Sf3b1 UTSW 1 55,055,949 (GRCm39) missense probably benign 0.00
R7644:Sf3b1 UTSW 1 55,036,302 (GRCm39) nonsense probably null
R7664:Sf3b1 UTSW 1 55,026,626 (GRCm39) missense probably damaging 1.00
R7735:Sf3b1 UTSW 1 55,042,508 (GRCm39) missense probably benign 0.29
R7809:Sf3b1 UTSW 1 55,034,614 (GRCm39) missense possibly damaging 0.60
R8516:Sf3b1 UTSW 1 55,051,262 (GRCm39) missense probably null 0.01
R8871:Sf3b1 UTSW 1 55,029,508 (GRCm39) missense probably damaging 1.00
R8947:Sf3b1 UTSW 1 55,039,444 (GRCm39) missense probably damaging 1.00
R9216:Sf3b1 UTSW 1 55,051,376 (GRCm39) missense probably benign 0.00
Z1177:Sf3b1 UTSW 1 55,042,561 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTTGCCTCCTAGATAATCTGTAAC -3'
(R):5'- AAAGTAGCTTTAATTTTCCCGTGGG -3'

Sequencing Primer
(F):5'- CTTACATCTTCAAGTTCAGTTGCAG -3'
(R):5'- GAGATAGTAAATCAGCTTTGTGTTCC -3'
Posted On 2018-06-06