Incidental Mutation 'R6531:Rassf5'
ID 522309
Institutional Source Beutler Lab
Gene Symbol Rassf5
Ensembl Gene ENSMUSG00000026430
Gene Name Ras association (RalGDS/AF-6) domain family member 5
Synonyms Nore1A, Nore1B, Rapl, 1300019G20Rik
MMRRC Submission 044657-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6531 (G1)
Quality Score 149.008
Status Validated
Chromosome 1
Chromosomal Location 131176410-131245258 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 131244814 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 106 (Q106L)
Ref Sequence ENSEMBL: ENSMUSP00000108061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027688] [ENSMUST00000112442]
AlphaFold Q5EBH1
Predicted Effect probably benign
Transcript: ENSMUST00000027688
AA Change: Q106L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027688
Gene: ENSMUSG00000026430
AA Change: Q106L

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
RA 267 359 1.07e-22 SMART
Pfam:Nore1-SARAH 366 405 1.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112442
AA Change: Q106L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108061
Gene: ENSMUSG00000026430
AA Change: Q106L

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
PDB:3DDC|B 198 301 7e-62 PDB
Blast:RA 267 294 5e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124796
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele have defects in lymphocyte homing to lymphoid tissues, B cell maturation and dendritic cell function, and display lymphocyte hyperproliferation leading to lupus glomerulonephritis and lymphomas. Homozygotes for another null allele are resistant to TNF-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Rassf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Rassf5 APN 1 131180599 missense probably damaging 0.96
IGL03055:Rassf5 UTSW 1 131244995 missense probably benign 0.00
R0464:Rassf5 UTSW 1 131212261 missense probably benign 0.00
R0589:Rassf5 UTSW 1 131244983 missense probably damaging 0.99
R0634:Rassf5 UTSW 1 131244956 missense probably damaging 0.99
R0639:Rassf5 UTSW 1 131245066 missense probably damaging 1.00
R0727:Rassf5 UTSW 1 131181265 missense probably damaging 1.00
R1926:Rassf5 UTSW 1 131212339 missense probably damaging 1.00
R2310:Rassf5 UTSW 1 131244740 missense probably damaging 1.00
R5354:Rassf5 UTSW 1 131180648 missense probably benign 0.00
R5422:Rassf5 UTSW 1 131181174 missense possibly damaging 0.87
R5490:Rassf5 UTSW 1 131181195 missense possibly damaging 0.95
R6189:Rassf5 UTSW 1 131244979 missense probably damaging 1.00
R6328:Rassf5 UTSW 1 131180668 missense probably damaging 1.00
R6759:Rassf5 UTSW 1 131182251 missense probably benign 0.08
R7115:Rassf5 UTSW 1 131181249 missense probably benign 0.21
R7350:Rassf5 UTSW 1 131178536 missense possibly damaging 0.75
R7910:Rassf5 UTSW 1 131180629 missense probably benign 0.15
R8286:Rassf5 UTSW 1 131212330 missense possibly damaging 0.73
R8706:Rassf5 UTSW 1 131245045 missense probably benign 0.00
R8732:Rassf5 UTSW 1 131178527 makesense probably null
R9023:Rassf5 UTSW 1 131212340 missense probably benign 0.07
Z1176:Rassf5 UTSW 1 131182217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGGACTGGCCACAAAAG -3'
(R):5'- TTTAAAAGCGCGCTCGACC -3'

Sequencing Primer
(F):5'- AATGGCCTCCTCTCCCGG -3'
(R):5'- CGCGGTATCTGCAGAGTCTG -3'
Posted On 2018-06-06