Mutagenetix > Incidental Mutations

Incidental Mutation 'R6564:Adam15'

522310

Institutional Source

Beutler Lab

Gene Symbol

Adam15

Ensembl Gene

ENSMUSG00000028041

Gene Name

a disintegrin and metallopeptidase domain 15 (metargidin)

Synonyms

MDC15, metargidin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.327) question?

Stock #

R6564 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89338542-89349996 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 89347212 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 121 (R121L)

Ref Sequence

ENSEMBL: ENSMUSP00000074167 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029676] [ENSMUST00000070820] [ENSMUST00000074582] [ENSMUST00000107446] [ENSMUST00000107448] [ENSMUST00000184651]

Predicted Effect

probably benign
Transcript: ENSMUST00000029676
AA Change: R121L

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000029676
Gene: ENSMUSG00000028041
AA Change: R121L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Pep_M12B_propep	29	158	1.2e-14	PFAM
Pfam:Reprolysin_3	208	360	1e-12	PFAM
Pfam:Reprolysin_5	212	394	1.5e-15	PFAM
Pfam:Reprolysin_4	214	410	3.1e-8	PFAM
Pfam:Reprolysin	214	416	1.6e-54	PFAM
Pfam:Reprolysin_2	257	405	9.9e-12	PFAM
DISIN	431	507	2.28e-37	SMART
ACR	508	650	8.38e-56	SMART
EGF	657	686	7.02e-1	SMART
transmembrane domain	695	717	N/A	INTRINSIC
low complexity region	763	781	N/A	INTRINSIC
low complexity region	808	862	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000070820

SMART Domains

Protein: ENSMUSP00000065502
Gene: ENSMUSG00000042672

Domain	Start	End	E-Value	Type
coiled coil region	18	44	N/A	INTRINSIC
transmembrane domain	74	96	N/A	INTRINSIC
transmembrane domain	108	125	N/A	INTRINSIC
transmembrane domain	398	420	N/A	INTRINSIC
Pfam:DC_STAMP	431	621	1.5e-55	PFAM
Blast:RING	672	710	3e-17	BLAST
SCOP:d1ldjb_	672	710	2e-3	SMART
low complexity region	717	728	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074582
AA Change: R121L

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000074167
Gene: ENSMUSG00000028041
AA Change: R121L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Pep_M12B_propep	31	164	2.6e-21	PFAM
Pfam:Reprolysin_5	212	394	1.6e-15	PFAM
Pfam:Reprolysin_4	214	410	2.9e-8	PFAM
Pfam:Reprolysin	214	415	4.2e-56	PFAM
Pfam:Reprolysin_3	238	360	1.7e-14	PFAM
Pfam:Reprolysin_2	254	405	1.1e-10	PFAM
DISIN	431	507	2.28e-37	SMART
ACR	508	650	8.38e-56	SMART
EGF	657	686	7.02e-1	SMART
transmembrane domain	695	717	N/A	INTRINSIC
low complexity region	760	813	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107446
AA Change: R121L

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103070
Gene: ENSMUSG00000028041
AA Change: R121L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Pep_M12B_propep	31	164	9.9e-22	PFAM
Pfam:Reprolysin_3	209	360	5.9e-15	PFAM
Pfam:Reprolysin_5	212	394	5e-16	PFAM
Pfam:Reprolysin_4	213	410	1e-8	PFAM
Pfam:Reprolysin	214	415	1.4e-56	PFAM
Pfam:Reprolysin_2	253	405	4e-11	PFAM
low complexity region	416	446	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107448
AA Change: R121L

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103072
Gene: ENSMUSG00000028041
AA Change: R121L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Pep_M12B_propep	31	164	2.7e-21	PFAM
Pfam:Reprolysin_5	212	394	1.6e-15	PFAM
Pfam:Reprolysin_4	214	410	3e-8	PFAM
Pfam:Reprolysin	214	415	4.4e-56	PFAM
Pfam:Reprolysin_3	238	360	1.8e-14	PFAM
Pfam:Reprolysin_2	254	405	1.2e-10	PFAM
DISIN	431	507	2.28e-37	SMART
ACR	508	650	8.38e-56	SMART
EGF	657	686	7.02e-1	SMART
transmembrane domain	695	717	N/A	INTRINSIC
low complexity region	783	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134590

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134839

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139467

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155295

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180791

Predicted Effect

probably benign
Transcript: ENSMUST00000184651
AA Change: R121L

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000139147
Gene: ENSMUSG00000028041
AA Change: R121L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Pep_M12B_propep	31	164	2.9e-21	PFAM
Pfam:Reprolysin_5	212	394	1.7e-15	PFAM
Pfam:Reprolysin_4	214	410	3.1e-8	PFAM
Pfam:Reprolysin	214	415	4.6e-56	PFAM
Pfam:Reprolysin_3	238	360	1.9e-14	PFAM
Pfam:Reprolysin_2	255	405	1.2e-10	PFAM
DISIN	431	507	2.28e-37	SMART
ACR	508	650	8.38e-56	SMART
EGF	657	686	7.02e-1	SMART
transmembrane domain	695	717	N/A	INTRINSIC
low complexity region	763	781	N/A	INTRINSIC
low complexity region	808	862	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is prominently expressed in vascular cells, the endocardium, hypertrophic cells in developing bone, and specific areas of hippocampus and cerebellum. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein have increased bone mass resulting from osteoblast proliferation, and exhibit reduced neovascularization in a mouse model for retinopathy. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice develop normally and exhibit normal angiogenesis, but show a resistance to pathological neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,486,077		probably null	Het
4931429L15Rik	C	A	9: 46,306,904	D179Y	probably damaging	Het
Abca1	A	T	4: 53,034,031	L2233Q	possibly damaging	Het
Abca12	T	A	1: 71,309,850	E834V	possibly damaging	Het
Abcc9	T	C	6: 142,603,108	Y1318C	probably damaging	Het
Afdn	T	A	17: 13,896,089	M1588K	probably benign	Het
Akap9	T	C	5: 4,028,491	S1849P	probably damaging	Het
Bag6	T	C	17: 35,140,371	S213P	probably damaging	Het
Bpifb9a	T	C	2: 154,260,178	V65A	probably benign	Het
Chn1	T	A	2: 73,618,041	I203F	probably damaging	Het
Crnkl1	T	A	2: 145,928,245	E226V	possibly damaging	Het
Cspg4	A	G	9: 56,890,158	E1302G	probably benign	Het
Dnah5	G	T	15: 28,367,745	A2759S	probably benign	Het
Doxl2	T	C	6: 48,977,575	V549A	probably benign	Het
Dtx1	T	A	5: 120,695,017	T119S	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ezr	C	T	17: 6,742,847	V268M	probably damaging	Het
Fbxl15	T	C	19: 46,329,338	V153A	probably damaging	Het
Fkbpl	C	A	17: 34,646,266	A336E	probably benign	Het
Gsg1l2	A	G	11: 67,786,504	T200A	possibly damaging	Het
H2afx	T	C	9: 44,334,912	Y51H	probably damaging	Het
Ifi213	A	C	1: 173,595,296	M1R	probably null	Het
Kcnt1	A	C	2: 25,911,051	D1045A	probably benign	Het
Kdm4a	C	A	4: 118,177,439	A32S	probably benign	Het
Klkb1	A	T	8: 45,273,634	V444E	probably damaging	Het
Mccc1	T	C	3: 35,976,676	T414A	probably damaging	Het
Miga1	A	C	3: 152,285,322	N367K	probably damaging	Het
Mmp7	A	G	9: 7,695,184	D49G	probably benign	Het
Nlrp1a	A	G	11: 71,123,572	L284P	probably damaging	Het
Olfr1411	T	C	1: 92,596,563	S15P	probably benign	Het
Olfr853	G	A	9: 19,537,210	T240I	possibly damaging	Het
Pbld1	T	A	10: 63,072,027	I224N	possibly damaging	Het
Pih1d1	A	T	7: 45,159,819	R276W	probably damaging	Het
Plekhg1	G	T	10: 3,964,153	V1292L	probably damaging	Het
Prex2	A	G	1: 11,101,061		probably null	Het
Rbm6	T	C	9: 107,833,498	Y498C	probably damaging	Het
Reps1	T	A	10: 18,122,392		probably null	Het
Ruvbl1	T	A	6: 88,479,226	I154N	possibly damaging	Het
Slc4a5	T	G	6: 83,280,060	F616V	possibly damaging	Het
Spag5	A	T	11: 78,315,575	T798S	probably damaging	Het
Spam1	T	A	6: 24,796,356	I102K	possibly damaging	Het
Sptbn2	C	A	19: 4,732,024	F430L	probably damaging	Het
Svs3a	T	A	2: 164,289,350	I21K	probably damaging	Het
Tet3	T	A	6: 83,386,070	I842L	possibly damaging	Het
Tlr2	T	A	3: 83,837,695	K360N	probably benign	Het
Tmem45b	C	G	9: 31,428,005	W138S	probably damaging	Het
Tpgs2	T	C	18: 25,158,287	E40G	probably damaging	Het
Traj40	T	C	14: 54,177,942		probably benign	Het
Trpm5	A	G	7: 143,072,770	S125P	probably damaging	Het
Ttc3	G	T	16: 94,442,611	C1158F	probably damaging	Het
Tubg1	T	C	11: 101,120,889	I74T	probably damaging	Het
Vav2	A	T	2: 27,279,185		probably null	Het
Wbp4	G	T	14: 79,467,428	H201N	probably damaging	Het
Wdhd1	A	G	14: 47,248,042	S821P	probably benign	Het
Wsb2	A	T	5: 117,370,560		probably null	Het
Zic5	A	G	14: 122,459,421	L594P	unknown	Het

Other mutations in Adam15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01929:Adam15	APN	3	89344138	missense	probably benign	0.03
IGL01994:Adam15	APN	3	89341505	splice site	probably benign
IGL02184:Adam15	APN	3	89345934	splice site	probably benign
IGL02501:Adam15	APN	3	89340462	missense	possibly damaging	0.82
IGL02821:Adam15	APN	3	89345356	missense	probably damaging	1.00
IGL02933:Adam15	APN	3	89343483	missense	possibly damaging	0.91
IGL03078:Adam15	APN	3	89345937	splice site	probably benign
IGL03185:Adam15	APN	3	89347905	missense	probably benign	0.41
PIT4280001:Adam15	UTSW	3	89343978	critical splice acceptor site	probably null
PIT4581001:Adam15	UTSW	3	89343832	missense	probably benign	0.00
R0559:Adam15	UTSW	3	89343778	missense	probably damaging	1.00
R1530:Adam15	UTSW	3	89349830	missense	probably damaging	0.99
R1670:Adam15	UTSW	3	89348510	splice site	probably benign
R1909:Adam15	UTSW	3	89345330	missense	probably benign	0.19
R3110:Adam15	UTSW	3	89347457	missense	probably benign	0.10
R3112:Adam15	UTSW	3	89347457	missense	probably benign	0.10
R3897:Adam15	UTSW	3	89346938	missense	probably benign	0.00
R4058:Adam15	UTSW	3	89347055	missense	possibly damaging	0.94
R4573:Adam15	UTSW	3	89345986	missense	probably damaging	1.00
R5267:Adam15	UTSW	3	89349899	utr 5 prime	probably benign
R5364:Adam15	UTSW	3	89345595	missense	probably damaging	1.00
R5801:Adam15	UTSW	3	89342361	missense	probably damaging	1.00
R5813:Adam15	UTSW	3	89345828	missense	probably benign	0.12
R5964:Adam15	UTSW	3	89343567	nonsense	probably null
R6218:Adam15	UTSW	3	89343883	missense	probably benign	0.00
R6579:Adam15	UTSW	3	89345629	missense	probably damaging	1.00
R6834:Adam15	UTSW	3	89340083	missense	probably damaging	0.96
R7131:Adam15	UTSW	3	89346980	missense	possibly damaging	0.64
R7204:Adam15	UTSW	3	89346937	missense	probably benign	0.01
R7578:Adam15	UTSW	3	89344192	missense	probably damaging	1.00
R7663:Adam15	UTSW	3	89345806	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCTCCAGTGTATAGCCTCTC -3'
(R):5'- GAGGGCTACAGTCTAGTGAGTC -3'

Sequencing Primer
(F):5'- GTATAGCCTCTCTCTGGGGAC -3'
(R):5'- TACAGTCTAGTGAGTCAGGCC -3'

Posted On

2018-06-06