Mutagenetix > Incidental Mutation

Incidental Mutation 'R6531:Tlk1'

522315

Institutional Source

Beutler Lab

Gene Symbol

Tlk1

Ensembl Gene

ENSMUSG00000041997

Gene Name

tousled-like kinase 1

Synonyms

4930545J15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6531 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70712407-70825728 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70742083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 380 (D380E)

Ref Sequence

ENSEMBL: ENSMUSP00000035961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038584]

AlphaFold

Q8C0V0

Predicted Effect

probably benign
Transcript: ENSMUST00000038584
AA Change: D380E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000035961
Gene: ENSMUSG00000041997
AA Change: D380E

Domain	Start	End	E-Value	Type
low complexity region	20	33	N/A	INTRINSIC
low complexity region	68	85	N/A	INTRINSIC
low complexity region	170	192	N/A	INTRINSIC
coiled coil region	248	277	N/A	INTRINSIC
coiled coil region	403	441	N/A	INTRINSIC
S_TKc	456	734	4.41e-75	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132542

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135128

Meta Mutation Damage Score

0.0681

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.2%
20x: 90.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,949,999	E880G	possibly damaging	Het
Acsbg2	T	A	17: 56,846,617	I529F	probably damaging	Het
Ahcyl2	T	G	6: 29,886,162	M359R	probably benign	Het
Aldh5a1	G	T	13: 24,918,564	D305E	probably benign	Het
Catsper2	C	G	2: 121,399,780	V358L	possibly damaging	Het
Cd200r4	C	T	16: 44,833,505	Q222*	probably null	Het
Col4a2	T	A	8: 11,408,135	D270E	probably benign	Het
Cux1	T	C	5: 136,275,119	D1401G	probably benign	Het
Cyp3a59	T	A	5: 146,098,217	M235K	probably benign	Het
Dock3	T	C	9: 106,967,216	D895G	probably benign	Het
Dusp27	A	T	1: 166,110,046		probably null	Het
Dync1h1	T	C	12: 110,617,920	F586L	probably damaging	Het
Elmo1	G	T	13: 20,572,446	R568L	possibly damaging	Het
Epb41	T	C	4: 131,957,636	T711A	probably benign	Het
Grm7	T	A	6: 111,358,425	M599K	probably benign	Het
Hivep3	A	T	4: 120,122,876	K1704*	probably null	Het
Ighv1-62-3	C	A	12: 115,461,006	C115F	probably damaging	Het
Krt78	A	G	15: 101,952,273	Y200H	probably benign	Het
Lamb2	A	T	9: 108,483,726	H549L	possibly damaging	Het
Mroh3	A	G	1: 136,184,353	I759T	probably benign	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Nol6	G	T	4: 41,118,154	P828T	probably benign	Het
Olfr1030	A	G	2: 85,984,307	I156V	probably benign	Het
Olfr1132	A	G	2: 87,635,529	Y73H	probably damaging	Het
Olfr1264	A	G	2: 90,021,457	V203A	probably benign	Het
Olfr344	G	A	2: 36,569,341	V248I	probably damaging	Het
Ovgp1	A	C	3: 105,987,071		probably benign	Het
Pitpnm3	T	A	11: 72,071,487	Q230L	possibly damaging	Het
Pkn1	C	T	8: 83,670,293	V910I	probably benign	Het
Plcb1	T	A	2: 135,325,802		probably null	Het
Ppp1r12c	A	G	7: 4,482,789		probably null	Het
Rassf5	T	A	1: 131,244,814	Q106L	possibly damaging	Het
Rfc1	T	C	5: 65,312,979	K62E	possibly damaging	Het
Sf3b1	C	T	1: 55,019,395	E12K	probably damaging	Het
Slc4a1ap	A	T	5: 31,548,638	D691V	probably benign	Het
Speg	T	A	1: 75,422,757	F2283I	probably benign	Het
Synj2	A	G	17: 6,033,839	K267E	probably damaging	Het
Tg	A	T	15: 66,839,362	Y991F	probably damaging	Het
Trim43b	A	T	9: 89,085,365	L405H	probably damaging	Het
Ttf2	A	G	3: 100,956,260	I586T	probably damaging	Het
Ugt2b36	T	A	5: 87,081,586	R213S	probably damaging	Het
Vmn1r198	T	A	13: 22,354,407	M21K	probably benign	Het
Wdr35	A	T	12: 8,978,685	Y101F	probably benign	Het
Zfp367	T	C	13: 64,144,250	Y189C	probably damaging	Het

Other mutations in Tlk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00673:Tlk1	APN	2	70745516	missense	probably damaging	1.00
IGL01087:Tlk1	APN	2	70752316	missense	possibly damaging	0.64
IGL01514:Tlk1	APN	2	70752266	missense	probably benign	0.00
IGL02976:Tlk1	APN	2	70721591	nonsense	probably null
IGL03024:Tlk1	APN	2	70746036	nonsense	probably null
Aku-aku	UTSW	2	70738445	missense	probably damaging	0.98
Heyerdahl	UTSW	2	70738426	nonsense	probably null
K3955:Tlk1	UTSW	2	70721701	missense	possibly damaging	0.85
R0107:Tlk1	UTSW	2	70713989	makesense	probably null
R0226:Tlk1	UTSW	2	70714169	unclassified	probably benign
R0332:Tlk1	UTSW	2	70745565	splice site	probably null
R0601:Tlk1	UTSW	2	70714158	missense	probably benign	0.44
R1739:Tlk1	UTSW	2	70721077	missense	probably damaging	1.00
R2080:Tlk1	UTSW	2	70738445	missense	probably damaging	0.98
R2422:Tlk1	UTSW	2	70770005	missense	probably damaging	1.00
R3843:Tlk1	UTSW	2	70749327	missense	probably benign	0.05
R3970:Tlk1	UTSW	2	70716652	missense	probably damaging	1.00
R4191:Tlk1	UTSW	2	70725547	missense	probably damaging	1.00
R4867:Tlk1	UTSW	2	70721571	nonsense	probably null
R5022:Tlk1	UTSW	2	70742065	missense	probably benign	0.10
R5275:Tlk1	UTSW	2	70752205	intron	probably benign
R5469:Tlk1	UTSW	2	70721668	missense	probably benign	0.15
R6592:Tlk1	UTSW	2	70714153	missense	probably damaging	1.00
R6797:Tlk1	UTSW	2	70738426	nonsense	probably null
R7030:Tlk1	UTSW	2	70721928	missense	probably damaging	1.00
R7705:Tlk1	UTSW	2	70786672	splice site	probably null
R7970:Tlk1	UTSW	2	70752300	missense	possibly damaging	0.64
R8284:Tlk1	UTSW	2	70714021	missense	probably benign
R8765:Tlk1	UTSW	2	70752237	missense	probably benign	0.20
R9004:Tlk1	UTSW	2	70721946	missense	probably damaging	1.00
R9059:Tlk1	UTSW	2	70786933	missense	possibly damaging	0.65
R9114:Tlk1	UTSW	2	70742158	missense	probably benign	0.20
R9408:Tlk1	UTSW	2	70786875	critical splice donor site	probably null
R9464:Tlk1	UTSW	2	70713997	missense	probably benign	0.00
R9622:Tlk1	UTSW	2	70786937	missense	probably damaging	1.00
R9768:Tlk1	UTSW	2	70770056	missense	probably damaging	0.99
R9776:Tlk1	UTSW	2	70725564	missense	probably damaging	1.00
X0028:Tlk1	UTSW	2	70746031	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTGCAGTGGTATAGGCAAC -3'
(R):5'- TTTACACAGGCAACAAGAATGG -3'

Sequencing Primer
(F):5'- ACATTCAGGCTTGGAGATTATGTCAG -3'
(R):5'- CACAGGCAACAAGAATGGGTGAATC -3'

Posted On

2018-06-06