Incidental Mutation 'R6531:Olfr1264'
ID522320
Institutional Source Beutler Lab
Gene Symbol Olfr1264
Ensembl Gene ENSMUSG00000075069
Gene Nameolfactory receptor 1264
SynonymsGA_x6K02T2Q125-51454183-51453257, MOR236-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R6531 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90018526-90025577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90021457 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 203 (V203A)
Ref Sequence ENSEMBL: ENSMUSP00000149126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099758] [ENSMUST00000214382] [ENSMUST00000216616] [ENSMUST00000217065]
Predicted Effect probably benign
Transcript: ENSMUST00000099758
AA Change: V203A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097347
Gene: ENSMUSG00000075069
AA Change: V203A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.8e-47 PFAM
Pfam:7tm_1 39 285 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214382
Predicted Effect probably benign
Transcript: ENSMUST00000216616
AA Change: V203A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216764
Predicted Effect probably benign
Transcript: ENSMUST00000217065
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Olfr1264
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1635:Olfr1264 UTSW 2 90021970 missense possibly damaging 0.94
R1758:Olfr1264 UTSW 2 90021329 missense probably benign
R1930:Olfr1264 UTSW 2 90021161 missense probably benign
R2159:Olfr1264 UTSW 2 90021538 missense probably damaging 0.97
R3977:Olfr1264 UTSW 2 90021745 missense probably damaging 1.00
R4028:Olfr1264 UTSW 2 90021223 missense probably damaging 1.00
R4884:Olfr1264 UTSW 2 90021643 missense probably benign 0.19
R5194:Olfr1264 UTSW 2 90021526 missense probably damaging 1.00
R5225:Olfr1264 UTSW 2 90021184 missense probably benign 0.00
R5399:Olfr1264 UTSW 2 90021923 missense probably benign 0.19
R5436:Olfr1264 UTSW 2 90021665 missense probably benign 0.25
R5753:Olfr1264 UTSW 2 90021503 missense possibly damaging 0.87
R6225:Olfr1264 UTSW 2 90021229 splice site probably null
R6391:Olfr1264 UTSW 2 90021631 missense probably benign 0.03
R7293:Olfr1264 UTSW 2 90021527 missense probably damaging 1.00
R7880:Olfr1264 UTSW 2 90022037 missense probably damaging 1.00
R8014:Olfr1264 UTSW 2 90021743 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGGTGTGAGAATACCATAAAACAC -3'
(R):5'- CATGACCAGGCACCTTTGTG -3'

Sequencing Primer
(F):5'- TCTATAGGTAAAGTAGTCGATGGAC -3'
(R):5'- GGCACCTTTGTGTCGTGC -3'
Posted On2018-06-06