Incidental Mutation 'R6564:Dtx1'
ID 522321
Institutional Source Beutler Lab
Gene Symbol Dtx1
Ensembl Gene ENSMUSG00000029603
Gene Name deltex 1, E3 ubiquitin ligase
Synonyms Fxit1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6564 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 120680202-120711927 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120695017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 119 (T119S)
Ref Sequence ENSEMBL: ENSMUSP00000031607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031607]
AlphaFold Q61010
Predicted Effect probably benign
Transcript: ENSMUST00000031607
AA Change: T119S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031607
Gene: ENSMUSG00000029603
AA Change: T119S

DomainStartEndE-ValueType
WWE 23 102 1.29e-38 SMART
WWE 104 179 3.88e-33 SMART
low complexity region 226 251 N/A INTRINSIC
low complexity region 258 290 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RING 418 478 5.82e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145174
Meta Mutation Damage Score 0.1343 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Studies in Drosophila have identified this gene as encoding a positive regulator of the Notch-signaling pathway. The human gene encodes a protein of unknown function; however, it may play a role in basic helix-loop-helix transcription factor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with normal B and T cell devlepment and function and no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,486,077 probably null Het
4931429L15Rik C A 9: 46,306,904 D179Y probably damaging Het
Abca1 A T 4: 53,034,031 L2233Q possibly damaging Het
Abca12 T A 1: 71,309,850 E834V possibly damaging Het
Abcc9 T C 6: 142,603,108 Y1318C probably damaging Het
Adam15 C A 3: 89,347,212 R121L possibly damaging Het
Afdn T A 17: 13,896,089 M1588K probably benign Het
Akap9 T C 5: 4,028,491 S1849P probably damaging Het
Bag6 T C 17: 35,140,371 S213P probably damaging Het
Bpifb9a T C 2: 154,260,178 V65A probably benign Het
Chn1 T A 2: 73,618,041 I203F probably damaging Het
Crnkl1 T A 2: 145,928,245 E226V possibly damaging Het
Cspg4 A G 9: 56,890,158 E1302G probably benign Het
Dnah5 G T 15: 28,367,745 A2759S probably benign Het
Doxl2 T C 6: 48,977,575 V549A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ezr C T 17: 6,742,847 V268M probably damaging Het
Fbxl15 T C 19: 46,329,338 V153A probably damaging Het
Fkbpl C A 17: 34,646,266 A336E probably benign Het
Gsg1l2 A G 11: 67,786,504 T200A possibly damaging Het
H2afx T C 9: 44,334,912 Y51H probably damaging Het
Ifi213 A C 1: 173,595,296 M1R probably null Het
Kcnt1 A C 2: 25,911,051 D1045A probably benign Het
Kdm4a C A 4: 118,177,439 A32S probably benign Het
Klkb1 A T 8: 45,273,634 V444E probably damaging Het
Mccc1 T C 3: 35,976,676 T414A probably damaging Het
Miga1 A C 3: 152,285,322 N367K probably damaging Het
Mmp7 A G 9: 7,695,184 D49G probably benign Het
Nlrp1a A G 11: 71,123,572 L284P probably damaging Het
Olfr1411 T C 1: 92,596,563 S15P probably benign Het
Olfr853 G A 9: 19,537,210 T240I possibly damaging Het
Pbld1 T A 10: 63,072,027 I224N possibly damaging Het
Pih1d1 A T 7: 45,159,819 R276W probably damaging Het
Plekhg1 G T 10: 3,964,153 V1292L probably damaging Het
Prex2 A G 1: 11,101,061 probably null Het
Rbm6 T C 9: 107,833,498 Y498C probably damaging Het
Reps1 T A 10: 18,122,392 probably null Het
Ruvbl1 T A 6: 88,479,226 I154N possibly damaging Het
Slc4a5 T G 6: 83,280,060 F616V possibly damaging Het
Spag5 A T 11: 78,315,575 T798S probably damaging Het
Spam1 T A 6: 24,796,356 I102K possibly damaging Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svs3a T A 2: 164,289,350 I21K probably damaging Het
Tet3 T A 6: 83,386,070 I842L possibly damaging Het
Tlr2 T A 3: 83,837,695 K360N probably benign Het
Tmem45b C G 9: 31,428,005 W138S probably damaging Het
Tpgs2 T C 18: 25,158,287 E40G probably damaging Het
Traj40 T C 14: 54,177,942 probably benign Het
Trpm5 A G 7: 143,072,770 S125P probably damaging Het
Ttc3 G T 16: 94,442,611 C1158F probably damaging Het
Tubg1 T C 11: 101,120,889 I74T probably damaging Het
Vav2 A T 2: 27,279,185 probably null Het
Wbp4 G T 14: 79,467,428 H201N probably damaging Het
Wdhd1 A G 14: 47,248,042 S821P probably benign Het
Wsb2 A T 5: 117,370,560 probably null Het
Zic5 A G 14: 122,459,421 L594P unknown Het
Other mutations in Dtx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Dtx1 APN 5 120681435 missense probably damaging 1.00
IGL03104:Dtx1 APN 5 120694965 missense possibly damaging 0.77
IGL03139:Dtx1 APN 5 120694890 missense probably damaging 0.96
R0094:Dtx1 UTSW 5 120682624 missense probably damaging 1.00
R0173:Dtx1 UTSW 5 120682753 unclassified probably benign
R0268:Dtx1 UTSW 5 120681291 missense probably damaging 1.00
R0375:Dtx1 UTSW 5 120681399 missense probably damaging 1.00
R0452:Dtx1 UTSW 5 120694992 missense possibly damaging 0.94
R1109:Dtx1 UTSW 5 120710419 start gained probably benign
R1456:Dtx1 UTSW 5 120710504 utr 5 prime probably benign
R1541:Dtx1 UTSW 5 120710346 start gained probably benign
R1554:Dtx1 UTSW 5 120683321 missense probably damaging 1.00
R2042:Dtx1 UTSW 5 120694476 missense probably benign 0.24
R2568:Dtx1 UTSW 5 120710184 missense possibly damaging 0.84
R3946:Dtx1 UTSW 5 120681286 missense possibly damaging 0.53
R4697:Dtx1 UTSW 5 120694408 critical splice donor site probably null
R6150:Dtx1 UTSW 5 120681363 missense probably damaging 1.00
R6980:Dtx1 UTSW 5 120681357 missense probably damaging 1.00
R7000:Dtx1 UTSW 5 120695083 missense probably damaging 0.98
R7399:Dtx1 UTSW 5 120682393 missense possibly damaging 0.60
R9117:Dtx1 UTSW 5 120710291 missense probably benign
Z1176:Dtx1 UTSW 5 120683295 missense probably benign
Z1177:Dtx1 UTSW 5 120681351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCGACTTGGGAATGGAGC -3'
(R):5'- TCTTTACAGCCCCTGGGTAC -3'

Sequencing Primer
(F):5'- TGGAGCCGACAGTGAGC -3'
(R):5'- TTGGTGGCAAGCACCTTC -3'
Posted On 2018-06-06