Incidental Mutation 'R6564:Spam1'
ID522323
Institutional Source Beutler Lab
Gene Symbol Spam1
Ensembl Gene ENSMUSG00000029682
Gene Namesperm adhesion molecule 1
SynonymsPh-20
MMRRC Submission
Accession Numbers

Genbank: NM_001079875.1, NM_009241.2

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6564 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24791188-24801048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24796356 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 102 (I102K)
Ref Sequence ENSEMBL: ENSMUSP00000143970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031693] [ENSMUST00000202331] [ENSMUST00000202569]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031693
AA Change: I102K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031693
Gene: ENSMUSG00000029682
AA Change: I102K

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000202331
AA Change: I102K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143944
Gene: ENSMUSG00000029682
AA Change: I102K

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000202569
AA Change: I102K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143970
Gene: ENSMUSG00000029682
AA Change: I102K

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202786
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Male homozygotes for a targeted null mutation are normally fertile, but in vitro their sperm are slower at clearing cells from the cumulus mass. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,486,077 probably null Het
4931429L15Rik C A 9: 46,306,904 D179Y probably damaging Het
Abca1 A T 4: 53,034,031 L2233Q possibly damaging Het
Abca12 T A 1: 71,309,850 E834V possibly damaging Het
Abcc9 T C 6: 142,603,108 Y1318C probably damaging Het
Adam15 C A 3: 89,347,212 R121L possibly damaging Het
Afdn T A 17: 13,896,089 M1588K probably benign Het
Akap9 T C 5: 4,028,491 S1849P probably damaging Het
Bag6 T C 17: 35,140,371 S213P probably damaging Het
Bpifb9a T C 2: 154,260,178 V65A probably benign Het
Chn1 T A 2: 73,618,041 I203F probably damaging Het
Crnkl1 T A 2: 145,928,245 E226V possibly damaging Het
Cspg4 A G 9: 56,890,158 E1302G probably benign Het
Dnah5 G T 15: 28,367,745 A2759S probably benign Het
Doxl2 T C 6: 48,977,575 V549A probably benign Het
Dtx1 T A 5: 120,695,017 T119S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ezr C T 17: 6,742,847 V268M probably damaging Het
Fbxl15 T C 19: 46,329,338 V153A probably damaging Het
Fkbpl C A 17: 34,646,266 A336E probably benign Het
Gsg1l2 A G 11: 67,786,504 T200A possibly damaging Het
H2afx T C 9: 44,334,912 Y51H probably damaging Het
Ifi213 A C 1: 173,595,296 M1R probably null Het
Kcnt1 A C 2: 25,911,051 D1045A probably benign Het
Kdm4a C A 4: 118,177,439 A32S probably benign Het
Klkb1 A T 8: 45,273,634 V444E probably damaging Het
Mccc1 T C 3: 35,976,676 T414A probably damaging Het
Miga1 A C 3: 152,285,322 N367K probably damaging Het
Mmp7 A G 9: 7,695,184 D49G probably benign Het
Nlrp1a A G 11: 71,123,572 L284P probably damaging Het
Olfr1411 T C 1: 92,596,563 S15P probably benign Het
Olfr853 G A 9: 19,537,210 T240I possibly damaging Het
Pbld1 T A 10: 63,072,027 I224N possibly damaging Het
Pih1d1 A T 7: 45,159,819 R276W probably damaging Het
Plekhg1 G T 10: 3,964,153 V1292L probably damaging Het
Prex2 A G 1: 11,101,061 probably null Het
Rbm6 T C 9: 107,833,498 Y498C probably damaging Het
Reps1 T A 10: 18,122,392 probably null Het
Ruvbl1 T A 6: 88,479,226 I154N possibly damaging Het
Slc4a5 T G 6: 83,280,060 F616V possibly damaging Het
Spag5 A T 11: 78,315,575 T798S probably damaging Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svs3a T A 2: 164,289,350 I21K probably damaging Het
Tet3 T A 6: 83,386,070 I842L possibly damaging Het
Tlr2 T A 3: 83,837,695 K360N probably benign Het
Tmem45b C G 9: 31,428,005 W138S probably damaging Het
Tpgs2 T C 18: 25,158,287 E40G probably damaging Het
Traj40 T C 14: 54,177,942 probably benign Het
Trpm5 A G 7: 143,072,770 S125P probably damaging Het
Ttc3 G T 16: 94,442,611 C1158F probably damaging Het
Tubg1 T C 11: 101,120,889 I74T probably damaging Het
Vav2 A T 2: 27,279,185 probably null Het
Wbp4 G T 14: 79,467,428 H201N probably damaging Het
Wdhd1 A G 14: 47,248,042 S821P probably benign Het
Wsb2 A T 5: 117,370,560 probably null Het
Zic5 A G 14: 122,459,421 L594P unknown Het
Other mutations in Spam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Spam1 APN 6 24796723 nonsense probably null
IGL02152:Spam1 APN 6 24800803 utr 3 prime probably benign
IGL02377:Spam1 APN 6 24796697 missense probably damaging 1.00
IGL02666:Spam1 APN 6 24796124 missense possibly damaging 0.67
IGL02968:Spam1 APN 6 24796443 missense possibly damaging 0.84
IGL03004:Spam1 APN 6 24796914 missense probably damaging 1.00
IGL03136:Spam1 APN 6 24797011 splice site probably benign
I2288:Spam1 UTSW 6 24796478 missense probably benign 0.00
I2289:Spam1 UTSW 6 24796478 missense probably benign 0.00
R0279:Spam1 UTSW 6 24800419 missense probably benign
R0454:Spam1 UTSW 6 24797838 missense probably damaging 0.99
R0486:Spam1 UTSW 6 24796395 missense probably damaging 1.00
R0734:Spam1 UTSW 6 24796949 missense probably benign 0.17
R0811:Spam1 UTSW 6 24796887 missense probably damaging 1.00
R0812:Spam1 UTSW 6 24796887 missense probably damaging 1.00
R1294:Spam1 UTSW 6 24796907 missense probably benign 0.12
R1703:Spam1 UTSW 6 24796257 missense probably damaging 1.00
R2156:Spam1 UTSW 6 24796268 missense probably damaging 1.00
R2163:Spam1 UTSW 6 24796847 missense probably benign 0.33
R2762:Spam1 UTSW 6 24796643 missense possibly damaging 0.94
R2970:Spam1 UTSW 6 24796725 missense probably damaging 1.00
R4646:Spam1 UTSW 6 24800587 missense probably benign 0.01
R4664:Spam1 UTSW 6 24796662 missense probably benign 0.01
R4923:Spam1 UTSW 6 24796656 missense probably damaging 1.00
R5452:Spam1 UTSW 6 24800732 missense probably benign 0.00
R5589:Spam1 UTSW 6 24796110 missense probably benign 0.01
R5591:Spam1 UTSW 6 24800546 missense probably damaging 0.99
R5861:Spam1 UTSW 6 24796571 missense probably benign
R6481:Spam1 UTSW 6 24796930 missense probably benign 0.01
R6754:Spam1 UTSW 6 24796316 missense probably damaging 0.97
R7103:Spam1 UTSW 6 24800584 missense probably benign 0.00
R7462:Spam1 UTSW 6 24796908 missense probably damaging 0.99
R7559:Spam1 UTSW 6 24800453 missense probably damaging 1.00
X0022:Spam1 UTSW 6 24797886 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GGGCACATTCCAAACAGTG -3'
(R):5'- GGTTTCCAGTTTCTCAACCAGG -3'

Sequencing Primer
(F):5'- CTGTGGATTATAGGGCAGCACC -3'
(R):5'- AGTTTCTCAACCAGGTAGGC -3'
Posted On2018-06-06