Incidental Mutation 'R6531:Catsper2'
ID522324
Institutional Source Beutler Lab
Gene Symbol Catsper2
Ensembl Gene ENSMUSG00000033486
Gene Namecation channel, sperm associated 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R6531 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121392631-121413792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 121399780 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 358 (V358L)
Ref Sequence ENSEMBL: ENSMUSP00000037222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038073] [ENSMUST00000154604]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038073
AA Change: V358L

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037222
Gene: ENSMUSG00000033486
AA Change: V358L

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:Ion_trans 105 350 1e-35 PFAM
low complexity region 422 447 N/A INTRINSIC
internal_repeat_1 450 473 3.72e-11 PROSPERO
internal_repeat_1 465 488 3.72e-11 PROSPERO
low complexity region 491 502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146521
Predicted Effect probably benign
Transcript: ENSMUST00000154604
SMART Domains Protein: ENSMUSP00000119091
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Meta Mutation Damage Score 0.1746 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. This gene is part of a tandem repeat on chromosome 15q15; the second copy of this gene is thought to be a pseudogene. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null male mice are infertile due to a sperm motility defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Catsper2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Catsper2 APN 2 121397892 splice site probably benign
IGL01830:Catsper2 APN 2 121407362 missense probably damaging 1.00
IGL03243:Catsper2 APN 2 121406819 missense probably benign 0.08
IGL03247:Catsper2 APN 2 121410200 missense probably benign 0.03
IGL03342:Catsper2 APN 2 121406736 missense probably damaging 0.99
FR4304:Catsper2 UTSW 2 121397542 nonsense probably null
FR4304:Catsper2 UTSW 2 121397782 utr 3 prime probably benign
FR4342:Catsper2 UTSW 2 121397793 utr 3 prime probably benign
FR4589:Catsper2 UTSW 2 121397779 utr 3 prime probably benign
FR4737:Catsper2 UTSW 2 121397540 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397542 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397779 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397782 utr 3 prime probably benign
FR4976:Catsper2 UTSW 2 121397795 utr 3 prime probably benign
R1463:Catsper2 UTSW 2 121406446 missense probably damaging 1.00
R1686:Catsper2 UTSW 2 121400042 critical splice donor site probably null
R2006:Catsper2 UTSW 2 121406357 nonsense probably null
R2163:Catsper2 UTSW 2 121400175 missense probably damaging 1.00
R4543:Catsper2 UTSW 2 121407409 nonsense probably null
R4888:Catsper2 UTSW 2 121397123 splice site probably null
R5121:Catsper2 UTSW 2 121397123 splice site probably null
R5323:Catsper2 UTSW 2 121406735 missense probably damaging 1.00
R5518:Catsper2 UTSW 2 121406363 missense possibly damaging 0.69
R5605:Catsper2 UTSW 2 121397052 missense possibly damaging 0.91
R6521:Catsper2 UTSW 2 121406807 missense probably damaging 1.00
R7055:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R7138:Catsper2 UTSW 2 121397063 missense possibly damaging 0.85
R7240:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R7247:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R7760:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
R7874:Catsper2 UTSW 2 121397572 utr 3 prime probably benign
RF028:Catsper2 UTSW 2 121397726 utr 3 prime probably benign
Z1176:Catsper2 UTSW 2 121407385 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTGATTCAGAGTGCTGTCTCC -3'
(R):5'- CCCAGTGTAGCAAGGAAGTG -3'

Sequencing Primer
(F):5'- GAGTGCTGTCTCCTACAAAAAG -3'
(R):5'- TGTAGCAAGGAAGTGTGGATATTG -3'
Posted On2018-06-06