Mutagenetix > Incidental Mutations

Incidental Mutation 'R6531:Plcb1'

522326

Institutional Source

Beutler Lab

Gene Symbol

Plcb1

Ensembl Gene

ENSMUSG00000051177

Gene Name

phospholipase C, beta 1

Synonyms

3110043I21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R6531 (G1)

Quality Score

158.009

Status

Validated

Chromosome

Chromosomal Location

134786067-135475258 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 135325802 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]

Predicted Effect

probably null
Transcript: ENSMUST00000070724

SMART Domains

Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	2.2e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.3e-7	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	997	1155	1.9e-64	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110116

SMART Domains

Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	4.1e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1176	2.9e-61	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000131552

SMART Domains

Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	3.9e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1148	8e-51	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153402

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.2%
20x: 90.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,949,999	E880G	possibly damaging	Het
Acsbg2	T	A	17: 56,846,617	I529F	probably damaging	Het
Ahcyl2	T	G	6: 29,886,162	M359R	probably benign	Het
Aldh5a1	G	T	13: 24,918,564	D305E	probably benign	Het
Catsper2	C	G	2: 121,399,780	V358L	possibly damaging	Het
Cd200r4	C	T	16: 44,833,505	Q222*	probably null	Het
Col4a2	T	A	8: 11,408,135	D270E	probably benign	Het
Cux1	T	C	5: 136,275,119	D1401G	probably benign	Het
Cyp3a59	T	A	5: 146,098,217	M235K	probably benign	Het
Dock3	T	C	9: 106,967,216	D895G	probably benign	Het
Dusp27	A	T	1: 166,110,046		probably null	Het
Dync1h1	T	C	12: 110,617,920	F586L	probably damaging	Het
Elmo1	G	T	13: 20,572,446	R568L	possibly damaging	Het
Epb41	T	C	4: 131,957,636	T711A	probably benign	Het
Grm7	T	A	6: 111,358,425	M599K	probably benign	Het
Hivep3	A	T	4: 120,122,876	K1704*	probably null	Het
Ighv1-62-3	C	A	12: 115,461,006	C115F	probably damaging	Het
Krt78	A	G	15: 101,952,273	Y200H	probably benign	Het
Lamb2	A	T	9: 108,483,726	H549L	possibly damaging	Het
Mroh3	A	G	1: 136,184,353	I759T	probably benign	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Nol6	G	T	4: 41,118,154	P828T	probably benign	Het
Olfr1030	A	G	2: 85,984,307	I156V	probably benign	Het
Olfr1132	A	G	2: 87,635,529	Y73H	probably damaging	Het
Olfr1264	A	G	2: 90,021,457	V203A	probably benign	Het
Olfr344	G	A	2: 36,569,341	V248I	probably damaging	Het
Ovgp1	A	C	3: 105,987,071		probably benign	Het
Pitpnm3	T	A	11: 72,071,487	Q230L	possibly damaging	Het
Pkn1	C	T	8: 83,670,293	V910I	probably benign	Het
Ppp1r12c	A	G	7: 4,482,789		probably null	Het
Rassf5	T	A	1: 131,244,814	Q106L	possibly damaging	Het
Rfc1	T	C	5: 65,312,979	K62E	possibly damaging	Het
Sf3b1	C	T	1: 55,019,395	E12K	probably damaging	Het
Slc4a1ap	A	T	5: 31,548,638	D691V	probably benign	Het
Speg	T	A	1: 75,422,757	F2283I	probably benign	Het
Synj2	A	G	17: 6,033,839	K267E	probably damaging	Het
Tg	A	T	15: 66,839,362	Y991F	probably damaging	Het
Tlk1	A	T	2: 70,742,083	D380E	probably benign	Het
Trim43b	A	T	9: 89,085,365	L405H	probably damaging	Het
Ttf2	A	G	3: 100,956,260	I586T	probably damaging	Het
Ugt2b36	T	A	5: 87,081,586	R213S	probably damaging	Het
Vmn1r198	T	A	13: 22,354,407	M21K	probably benign	Het
Wdr35	A	T	12: 8,978,685	Y101F	probably benign	Het
Zfp367	T	C	13: 64,144,250	Y189C	probably damaging	Het

Other mutations in Plcb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Plcb1	APN	2	135251756	missense	possibly damaging	0.66
IGL01152:Plcb1	APN	2	134813659	missense	probably damaging	1.00
IGL01945:Plcb1	APN	2	135220791	missense	probably benign	0.03
IGL01999:Plcb1	APN	2	135346318	missense	probably damaging	1.00
IGL02109:Plcb1	APN	2	134786559	missense	probably damaging	1.00
IGL02153:Plcb1	APN	2	135387853	missense	probably benign	0.08
IGL02207:Plcb1	APN	2	135387171	missense	probably damaging	1.00
IGL02566:Plcb1	APN	2	135472263	missense	probably benign	0.17
IGL02590:Plcb1	APN	2	135294864	missense	probably benign	0.08
IGL02640:Plcb1	APN	2	135220859	splice site	probably benign
IGL02926:Plcb1	APN	2	135364762	splice site	probably benign
IGL03071:Plcb1	APN	2	135387802	missense	probably damaging	1.00
IGL03236:Plcb1	APN	2	135346306	missense	probably damaging	1.00
IGL03252:Plcb1	APN	2	135370428	missense	probably benign
IGL03387:Plcb1	APN	2	134813686	splice site	probably benign
BB001:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
BB011:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0308:Plcb1	UTSW	2	134813614	missense	probably benign	0.01
R0415:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
R0624:Plcb1	UTSW	2	135294911	missense	possibly damaging	0.81
R0898:Plcb1	UTSW	2	135387143	missense	possibly damaging	0.73
R1071:Plcb1	UTSW	2	135325657	missense	possibly damaging	0.64
R1615:Plcb1	UTSW	2	135362444	splice site	probably benign
R1617:Plcb1	UTSW	2	135337441	missense	probably damaging	1.00
R1785:Plcb1	UTSW	2	135325667	nonsense	probably null
R1866:Plcb1	UTSW	2	135344173	missense	probably benign	0.01
R1869:Plcb1	UTSW	2	135311014	missense	probably benign	0.02
R1902:Plcb1	UTSW	2	134813613	missense	possibly damaging	0.93
R1938:Plcb1	UTSW	2	135386302	missense	probably damaging	1.00
R2016:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2017:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2131:Plcb1	UTSW	2	135325667	nonsense	probably null
R2132:Plcb1	UTSW	2	135325667	nonsense	probably null
R2133:Plcb1	UTSW	2	135325667	nonsense	probably null
R2164:Plcb1	UTSW	2	135346330	missense	possibly damaging	0.87
R2419:Plcb1	UTSW	2	135262100	splice site	probably benign
R2429:Plcb1	UTSW	2	135337442	missense	probably damaging	0.99
R2508:Plcb1	UTSW	2	135260508	missense	probably benign	0.27
R3161:Plcb1	UTSW	2	135335482	missense	probably benign	0.03
R3870:Plcb1	UTSW	2	135325671	missense	probably damaging	0.99
R4191:Plcb1	UTSW	2	135345090	missense	probably damaging	1.00
R4239:Plcb1	UTSW	2	135344158	missense	probably damaging	0.99
R4552:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4553:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4720:Plcb1	UTSW	2	135251747	missense	possibly damaging	0.70
R4946:Plcb1	UTSW	2	135345095	missense	probably benign	0.01
R5012:Plcb1	UTSW	2	135333400	missense	probably null	0.97
R5151:Plcb1	UTSW	2	135262245	missense	probably benign	0.28
R5320:Plcb1	UTSW	2	135252776	missense	possibly damaging	0.56
R5415:Plcb1	UTSW	2	135347402	missense	possibly damaging	0.67
R5523:Plcb1	UTSW	2	135260566	missense	probably benign	0.08
R5568:Plcb1	UTSW	2	135370593	missense	probably damaging	1.00
R5688:Plcb1	UTSW	2	135335480	missense	probably benign	0.06
R5809:Plcb1	UTSW	2	135262244	missense	possibly damaging	0.83
R6237:Plcb1	UTSW	2	135370566	missense	possibly damaging	0.94
R6315:Plcb1	UTSW	2	135346341	missense	probably benign	0.00
R6478:Plcb1	UTSW	2	135335451	missense	probably damaging	1.00
R6683:Plcb1	UTSW	2	134786593	missense	probably benign	0.32
R6760:Plcb1	UTSW	2	135472060	missense	possibly damaging	0.50
R6947:Plcb1	UTSW	2	135386155	missense	probably benign	0.08
R6976:Plcb1	UTSW	2	135262239	missense	possibly damaging	0.75
R7379:Plcb1	UTSW	2	135370510	missense	probably benign	0.45
R7473:Plcb1	UTSW	2	135344276	missense	probably damaging	0.98
R7492:Plcb1	UTSW	2	135251764	nonsense	probably null
R7498:Plcb1	UTSW	2	135262233	nonsense	probably null
R7498:Plcb1	UTSW	2	135262234	missense	probably damaging	0.99
R7777:Plcb1	UTSW	2	135220757	missense	possibly damaging	0.51
R7924:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R8061:Plcb1	UTSW	2	135346396	missense	probably benign
R8099:Plcb1	UTSW	2	135251734	missense	possibly damaging	0.68
R8299:Plcb1	UTSW	2	135335476	missense	probably damaging	1.00
R8394:Plcb1	UTSW	2	135317790	missense	probably damaging	1.00
R8439:Plcb1	UTSW	2	135250052	critical splice donor site	probably null
R8549:Plcb1	UTSW	2	135364933	missense	probably benign	0.00
S24628:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
X0025:Plcb1	UTSW	2	135345054	missense	possibly damaging	0.87
Z1088:Plcb1	UTSW	2	135220846	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GCTATCCAAAGCAGTGGGATTAG -3'
(R):5'- TCCAGAAGCTTTCTCAGAAACC -3'

Sequencing Primer
(F):5'- TTAAATAGCTGGAATCTGGGGTAC -3'
(R):5'- GAAGCTTTCTCAGAAACCTTTCGAC -3'

Posted On

2018-06-06