Incidental Mutation 'R6531:Plcb1'
ID 522326
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Name phospholipase C, beta 1
Synonyms 3110043I21Rik
MMRRC Submission 044657-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R6531 (G1)
Quality Score 158.009
Status Validated
Chromosome 2
Chromosomal Location 134628084-135317178 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 135167722 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
AlphaFold Q9Z1B3
Predicted Effect probably null
Transcript: ENSMUST00000070724
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110116
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131552
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153402
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,926,980 (GRCm39) E880G possibly damaging Het
Acsbg2 T A 17: 57,153,617 (GRCm39) I529F probably damaging Het
Ahcyl2 T G 6: 29,886,161 (GRCm39) M359R probably benign Het
Aldh5a1 G T 13: 25,102,547 (GRCm39) D305E probably benign Het
Catsper2 C G 2: 121,230,261 (GRCm39) V358L possibly damaging Het
Cd200r4 C T 16: 44,653,868 (GRCm39) Q222* probably null Het
Col4a2 T A 8: 11,458,135 (GRCm39) D270E probably benign Het
Cux1 T C 5: 136,303,973 (GRCm39) D1401G probably benign Het
Cyp3a59 T A 5: 146,035,027 (GRCm39) M235K probably benign Het
Dock3 T C 9: 106,844,415 (GRCm39) D895G probably benign Het
Dync1h1 T C 12: 110,584,354 (GRCm39) F586L probably damaging Het
Elmo1 G T 13: 20,756,616 (GRCm39) R568L possibly damaging Het
Epb41 T C 4: 131,684,947 (GRCm39) T711A probably benign Het
Grm7 T A 6: 111,335,386 (GRCm39) M599K probably benign Het
Hivep3 A T 4: 119,980,073 (GRCm39) K1704* probably null Het
Ighv1-62-3 C A 12: 115,424,626 (GRCm39) C115F probably damaging Het
Krt78 A G 15: 101,860,708 (GRCm39) Y200H probably benign Het
Lamb2 A T 9: 108,360,925 (GRCm39) H549L possibly damaging Het
Mroh3 A G 1: 136,112,091 (GRCm39) I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,775,161 (GRCm39) probably null Het
Nol6 G T 4: 41,118,154 (GRCm39) P828T probably benign Het
Or1j15 G A 2: 36,459,353 (GRCm39) V248I probably damaging Het
Or4c3 A G 2: 89,851,801 (GRCm39) V203A probably benign Het
Or5m5 A G 2: 85,814,651 (GRCm39) I156V probably benign Het
Or8w1 A G 2: 87,465,873 (GRCm39) Y73H probably damaging Het
Ovgp1 A C 3: 105,894,387 (GRCm39) probably benign Het
Pitpnm3 T A 11: 71,962,313 (GRCm39) Q230L possibly damaging Het
Pkn1 C T 8: 84,396,922 (GRCm39) V910I probably benign Het
Ppp1r12c A G 7: 4,485,788 (GRCm39) probably null Het
Rassf5 T A 1: 131,172,551 (GRCm39) Q106L possibly damaging Het
Rfc1 T C 5: 65,470,322 (GRCm39) K62E possibly damaging Het
Sf3b1 C T 1: 55,058,554 (GRCm39) E12K probably damaging Het
Slc4a1ap A T 5: 31,705,982 (GRCm39) D691V probably benign Het
Speg T A 1: 75,399,401 (GRCm39) F2283I probably benign Het
Styxl2 A T 1: 165,937,615 (GRCm39) probably null Het
Synj2 A G 17: 6,084,114 (GRCm39) K267E probably damaging Het
Tg A T 15: 66,711,211 (GRCm39) Y991F probably damaging Het
Tlk1 A T 2: 70,572,427 (GRCm39) D380E probably benign Het
Trim43b A T 9: 88,967,418 (GRCm39) L405H probably damaging Het
Ttf2 A G 3: 100,863,576 (GRCm39) I586T probably damaging Het
Ugt2b36 T A 5: 87,229,445 (GRCm39) R213S probably damaging Het
Vmn1r198 T A 13: 22,538,577 (GRCm39) M21K probably benign Het
Wdr35 A T 12: 9,028,685 (GRCm39) Y101F probably benign Het
Zfp367 T C 13: 64,292,064 (GRCm39) Y189C probably damaging Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135,093,676 (GRCm39) missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134,655,579 (GRCm39) missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135,062,711 (GRCm39) missense probably benign 0.03
IGL01999:Plcb1 APN 2 135,188,238 (GRCm39) missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134,628,479 (GRCm39) missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135,229,773 (GRCm39) missense probably benign 0.08
IGL02207:Plcb1 APN 2 135,229,091 (GRCm39) missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135,314,183 (GRCm39) missense probably benign 0.17
IGL02590:Plcb1 APN 2 135,136,784 (GRCm39) missense probably benign 0.08
IGL02640:Plcb1 APN 2 135,062,779 (GRCm39) splice site probably benign
IGL02926:Plcb1 APN 2 135,206,682 (GRCm39) splice site probably benign
IGL03071:Plcb1 APN 2 135,229,722 (GRCm39) missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135,188,226 (GRCm39) missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135,212,348 (GRCm39) missense probably benign
IGL03387:Plcb1 APN 2 134,655,606 (GRCm39) splice site probably benign
BB001:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
BB011:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
R0024:Plcb1 UTSW 2 135,204,345 (GRCm39) missense probably benign 0.06
R0024:Plcb1 UTSW 2 135,204,345 (GRCm39) missense probably benign 0.06
R0053:Plcb1 UTSW 2 135,136,835 (GRCm39) missense probably benign 0.33
R0053:Plcb1 UTSW 2 135,136,835 (GRCm39) missense probably benign 0.33
R0308:Plcb1 UTSW 2 134,655,534 (GRCm39) missense probably benign 0.01
R0415:Plcb1 UTSW 2 135,179,419 (GRCm39) missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135,136,831 (GRCm39) missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135,229,063 (GRCm39) missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135,167,577 (GRCm39) missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135,204,364 (GRCm39) splice site probably benign
R1617:Plcb1 UTSW 2 135,179,361 (GRCm39) missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R1866:Plcb1 UTSW 2 135,186,093 (GRCm39) missense probably benign 0.01
R1869:Plcb1 UTSW 2 135,152,934 (GRCm39) missense probably benign 0.02
R1902:Plcb1 UTSW 2 134,655,533 (GRCm39) missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135,228,222 (GRCm39) missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135,204,340 (GRCm39) missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135,204,340 (GRCm39) missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2132:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2133:Plcb1 UTSW 2 135,167,587 (GRCm39) nonsense probably null
R2164:Plcb1 UTSW 2 135,188,250 (GRCm39) missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135,104,020 (GRCm39) splice site probably benign
R2429:Plcb1 UTSW 2 135,179,362 (GRCm39) missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135,102,428 (GRCm39) missense probably benign 0.27
R3161:Plcb1 UTSW 2 135,177,402 (GRCm39) missense probably benign 0.03
R3870:Plcb1 UTSW 2 135,167,591 (GRCm39) missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135,187,010 (GRCm39) missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135,186,078 (GRCm39) missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135,177,413 (GRCm39) missense probably benign 0.44
R4553:Plcb1 UTSW 2 135,177,413 (GRCm39) missense probably benign 0.44
R4720:Plcb1 UTSW 2 135,093,667 (GRCm39) missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135,187,015 (GRCm39) missense probably benign 0.01
R5012:Plcb1 UTSW 2 135,175,320 (GRCm39) missense probably null 0.97
R5151:Plcb1 UTSW 2 135,104,165 (GRCm39) missense probably benign 0.28
R5320:Plcb1 UTSW 2 135,094,696 (GRCm39) missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135,189,322 (GRCm39) missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135,102,486 (GRCm39) missense probably benign 0.08
R5568:Plcb1 UTSW 2 135,212,513 (GRCm39) missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135,177,400 (GRCm39) missense probably benign 0.06
R5809:Plcb1 UTSW 2 135,104,164 (GRCm39) missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135,212,486 (GRCm39) missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135,188,261 (GRCm39) missense probably benign 0.00
R6478:Plcb1 UTSW 2 135,177,371 (GRCm39) missense probably damaging 1.00
R6683:Plcb1 UTSW 2 134,628,513 (GRCm39) missense probably benign 0.32
R6760:Plcb1 UTSW 2 135,313,980 (GRCm39) missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135,228,075 (GRCm39) missense probably benign 0.08
R6976:Plcb1 UTSW 2 135,104,159 (GRCm39) missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135,212,430 (GRCm39) missense probably benign 0.45
R7473:Plcb1 UTSW 2 135,186,196 (GRCm39) missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135,093,684 (GRCm39) nonsense probably null
R7498:Plcb1 UTSW 2 135,104,154 (GRCm39) missense probably damaging 0.99
R7498:Plcb1 UTSW 2 135,104,153 (GRCm39) nonsense probably null
R7777:Plcb1 UTSW 2 135,062,677 (GRCm39) missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135,201,613 (GRCm39) missense probably benign 0.00
R8061:Plcb1 UTSW 2 135,188,316 (GRCm39) missense probably benign
R8099:Plcb1 UTSW 2 135,093,654 (GRCm39) missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135,177,396 (GRCm39) missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135,159,710 (GRCm39) missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135,091,972 (GRCm39) critical splice donor site probably null
R8549:Plcb1 UTSW 2 135,206,853 (GRCm39) missense probably benign 0.00
R8693:Plcb1 UTSW 2 135,094,696 (GRCm39) missense probably benign 0.00
R8750:Plcb1 UTSW 2 135,177,369 (GRCm39) missense probably damaging 1.00
R8817:Plcb1 UTSW 2 135,175,429 (GRCm39) intron probably benign
R8950:Plcb1 UTSW 2 135,179,439 (GRCm39) missense probably damaging 1.00
R9146:Plcb1 UTSW 2 135,182,615 (GRCm39) missense probably damaging 1.00
R9301:Plcb1 UTSW 2 135,167,610 (GRCm39) missense possibly damaging 0.96
R9311:Plcb1 UTSW 2 135,189,385 (GRCm39) missense probably benign 0.00
R9459:Plcb1 UTSW 2 135,164,558 (GRCm39) missense probably benign 0.03
S24628:Plcb1 UTSW 2 135,179,419 (GRCm39) missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135,186,974 (GRCm39) missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135,062,766 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTATCCAAAGCAGTGGGATTAG -3'
(R):5'- TCCAGAAGCTTTCTCAGAAACC -3'

Sequencing Primer
(F):5'- TTAAATAGCTGGAATCTGGGGTAC -3'
(R):5'- GAAGCTTTCTCAGAAACCTTTCGAC -3'
Posted On 2018-06-06