Incidental Mutation 'R6564:Ruvbl1'
ID522331
Institutional Source Beutler Lab
Gene Symbol Ruvbl1
Ensembl Gene ENSMUSG00000030079
Gene NameRuvB-like protein 1
SynonymsTip49a, 2510009G06Rik, Pontin52
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R6564 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location88465409-88497572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88479226 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 154 (I154N)
Ref Sequence ENSEMBL: ENSMUSP00000032165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032165] [ENSMUST00000129035]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032165
AA Change: I154N

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032165
Gene: ENSMUSG00000030079
AA Change: I154N

DomainStartEndE-ValueType
AAA 62 365 1.51e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000129035
AA Change: I94N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117925
Gene: ENSMUSG00000030079
AA Change: I94N

DomainStartEndE-ValueType
Pfam:AAA_19 1 77 1.3e-7 PFAM
Pfam:TIP49 1 134 2.7e-60 PFAM
Pfam:RuvB_N 2 52 5.5e-7 PFAM
Pfam:AAA 6 80 1.5e-10 PFAM
Meta Mutation Damage Score 0.5392 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has both DNA-dependent ATPase and DNA helicase activities and belongs to the ATPases associated with diverse cellular activities (AAA+) protein family. The encoded protein associates with several multisubunit transcriptional complexes and with protein complexes involved in both ATP-dependent remodeling and histone modification. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele show impaired proliferation of the pluripotent inner mass cells and embryonic lethality before implantation. Conditional ablation of this gene in hematopoietic tissues leads to bone marrow failure involving apoptotic loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,486,077 probably null Het
4931429L15Rik C A 9: 46,306,904 D179Y probably damaging Het
Abca1 A T 4: 53,034,031 L2233Q possibly damaging Het
Abca12 T A 1: 71,309,850 E834V possibly damaging Het
Abcc9 T C 6: 142,603,108 Y1318C probably damaging Het
Adam15 C A 3: 89,347,212 R121L possibly damaging Het
Afdn T A 17: 13,896,089 M1588K probably benign Het
Akap9 T C 5: 4,028,491 S1849P probably damaging Het
Bag6 T C 17: 35,140,371 S213P probably damaging Het
Bpifb9a T C 2: 154,260,178 V65A probably benign Het
Chn1 T A 2: 73,618,041 I203F probably damaging Het
Crnkl1 T A 2: 145,928,245 E226V possibly damaging Het
Cspg4 A G 9: 56,890,158 E1302G probably benign Het
Dnah5 G T 15: 28,367,745 A2759S probably benign Het
Doxl2 T C 6: 48,977,575 V549A probably benign Het
Dtx1 T A 5: 120,695,017 T119S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ezr C T 17: 6,742,847 V268M probably damaging Het
Fbxl15 T C 19: 46,329,338 V153A probably damaging Het
Fkbpl C A 17: 34,646,266 A336E probably benign Het
Gsg1l2 A G 11: 67,786,504 T200A possibly damaging Het
H2afx T C 9: 44,334,912 Y51H probably damaging Het
Ifi213 A C 1: 173,595,296 M1R probably null Het
Kcnt1 A C 2: 25,911,051 D1045A probably benign Het
Kdm4a C A 4: 118,177,439 A32S probably benign Het
Klkb1 A T 8: 45,273,634 V444E probably damaging Het
Mccc1 T C 3: 35,976,676 T414A probably damaging Het
Miga1 A C 3: 152,285,322 N367K probably damaging Het
Mmp7 A G 9: 7,695,184 D49G probably benign Het
Nlrp1a A G 11: 71,123,572 L284P probably damaging Het
Olfr1411 T C 1: 92,596,563 S15P probably benign Het
Olfr853 G A 9: 19,537,210 T240I possibly damaging Het
Pbld1 T A 10: 63,072,027 I224N possibly damaging Het
Pih1d1 A T 7: 45,159,819 R276W probably damaging Het
Plekhg1 G T 10: 3,964,153 V1292L probably damaging Het
Prex2 A G 1: 11,101,061 probably null Het
Rbm6 T C 9: 107,833,498 Y498C probably damaging Het
Reps1 T A 10: 18,122,392 probably null Het
Slc4a5 T G 6: 83,280,060 F616V possibly damaging Het
Spag5 A T 11: 78,315,575 T798S probably damaging Het
Spam1 T A 6: 24,796,356 I102K possibly damaging Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svs3a T A 2: 164,289,350 I21K probably damaging Het
Tet3 T A 6: 83,386,070 I842L possibly damaging Het
Tlr2 T A 3: 83,837,695 K360N probably benign Het
Tmem45b C G 9: 31,428,005 W138S probably damaging Het
Tpgs2 T C 18: 25,158,287 E40G probably damaging Het
Traj40 T C 14: 54,177,942 probably benign Het
Trpm5 A G 7: 143,072,770 S125P probably damaging Het
Ttc3 G T 16: 94,442,611 C1158F probably damaging Het
Tubg1 T C 11: 101,120,889 I74T probably damaging Het
Vav2 A T 2: 27,279,185 probably null Het
Wbp4 G T 14: 79,467,428 H201N probably damaging Het
Wdhd1 A G 14: 47,248,042 S821P probably benign Het
Wsb2 A T 5: 117,370,560 probably null Het
Zic5 A G 14: 122,459,421 L594P unknown Het
Other mutations in Ruvbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ruvbl1 APN 6 88484403 unclassified probably benign
IGL00473:Ruvbl1 APN 6 88491568 missense probably damaging 1.00
IGL01768:Ruvbl1 APN 6 88497271 missense probably benign
IGL03354:Ruvbl1 APN 6 88479215 nonsense probably null
R0106:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R0106:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R0145:Ruvbl1 UTSW 6 88484459 missense possibly damaging 0.90
R0676:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R1448:Ruvbl1 UTSW 6 88467569 missense probably benign 0.05
R1561:Ruvbl1 UTSW 6 88479154 missense probably damaging 1.00
R1574:Ruvbl1 UTSW 6 88479154 missense probably damaging 1.00
R1623:Ruvbl1 UTSW 6 88485770 missense probably damaging 1.00
R2113:Ruvbl1 UTSW 6 88483021 missense probably damaging 0.99
R2372:Ruvbl1 UTSW 6 88485797 missense possibly damaging 0.53
R2397:Ruvbl1 UTSW 6 88465552 missense possibly damaging 0.71
R2894:Ruvbl1 UTSW 6 88479132 missense possibly damaging 0.87
R4037:Ruvbl1 UTSW 6 88473135 missense probably damaging 1.00
R4604:Ruvbl1 UTSW 6 88485905 missense probably benign
R4684:Ruvbl1 UTSW 6 88491599 missense probably benign 0.00
R4714:Ruvbl1 UTSW 6 88484430 missense possibly damaging 0.61
R4835:Ruvbl1 UTSW 6 88497229 missense possibly damaging 0.69
R4939:Ruvbl1 UTSW 6 88483039 unclassified probably null
R5114:Ruvbl1 UTSW 6 88497290 missense probably benign 0.41
R5126:Ruvbl1 UTSW 6 88485901 missense probably benign 0.13
R5296:Ruvbl1 UTSW 6 88485908 missense probably damaging 0.99
R5507:Ruvbl1 UTSW 6 88467600 missense probably benign 0.00
R5559:Ruvbl1 UTSW 6 88473096 missense possibly damaging 0.90
R5819:Ruvbl1 UTSW 6 88483115 splice site probably null
R6048:Ruvbl1 UTSW 6 88482991 missense possibly damaging 0.90
R6155:Ruvbl1 UTSW 6 88479125 critical splice acceptor site probably null
R6704:Ruvbl1 UTSW 6 88479205 missense probably benign 0.06
R7681:Ruvbl1 UTSW 6 88467653 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCCACAGTGATATCCTTCTGC -3'
(R):5'- CACCCTACAATGACCTGTGC -3'

Sequencing Primer
(F):5'- TGGTTTGCCATAGATGTTTATGAC -3'
(R):5'- TACAATGACCTGTGCAGCTC -3'
Posted On2018-06-06