Mutagenetix > Incidental Mutation

Incidental Mutation 'R6531:Nol6'

522332

Institutional Source

Beutler Lab

Gene Symbol

Nol6

Ensembl Gene

ENSMUSG00000028430

Gene Name

nucleolar protein family 6 (RNA-associated)

Synonyms

Nrap

MMRRC Submission

044657-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R6531 (G1)

Quality Score

210.009

Status

Validated

Chromosome

Chromosomal Location

41114427-41124455 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 41118154 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 828 (P828T)

Ref Sequence

ENSEMBL: ENSMUSP00000030138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030138]

AlphaFold

Q8R5K4

Predicted Effect

probably benign
Transcript: ENSMUST00000030138
AA Change: P828T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000030138
Gene: ENSMUSG00000028430
AA Change: P828T

Domain	Start	End	E-Value	Type
Pfam:Nrap	174	1145	5e-287	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129112

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135059

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155315

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.2%
20x: 90.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleolus is a dense subnuclear membraneless organelle that assembles around clusters of rRNA genes and functions in ribosome biogenesis. This gene encodes a nucleolar RNA-associated protein that is highly conserved between species. RNase treatment of permeabilized cells indicates that the nucleolar localization is RNA dependent. Further studies suggest that the protein is associated with ribosome biogenesis through an interaction with pre-rRNA primary transcripts. Alternative splicing has been observed at this locus and two splice variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,949,999	E880G	possibly damaging	Het
Acsbg2	T	A	17: 56,846,617	I529F	probably damaging	Het
Ahcyl2	T	G	6: 29,886,162	M359R	probably benign	Het
Aldh5a1	G	T	13: 24,918,564	D305E	probably benign	Het
Catsper2	C	G	2: 121,399,780	V358L	possibly damaging	Het
Cd200r4	C	T	16: 44,833,505	Q222*	probably null	Het
Col4a2	T	A	8: 11,408,135	D270E	probably benign	Het
Cux1	T	C	5: 136,275,119	D1401G	probably benign	Het
Cyp3a59	T	A	5: 146,098,217	M235K	probably benign	Het
Dock3	T	C	9: 106,967,216	D895G	probably benign	Het
Dusp27	A	T	1: 166,110,046		probably null	Het
Dync1h1	T	C	12: 110,617,920	F586L	probably damaging	Het
Elmo1	G	T	13: 20,572,446	R568L	possibly damaging	Het
Epb41	T	C	4: 131,957,636	T711A	probably benign	Het
Grm7	T	A	6: 111,358,425	M599K	probably benign	Het
Hivep3	A	T	4: 120,122,876	K1704*	probably null	Het
Ighv1-62-3	C	A	12: 115,461,006	C115F	probably damaging	Het
Krt78	A	G	15: 101,952,273	Y200H	probably benign	Het
Lamb2	A	T	9: 108,483,726	H549L	possibly damaging	Het
Mroh3	A	G	1: 136,184,353	I759T	probably benign	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Olfr1030	A	G	2: 85,984,307	I156V	probably benign	Het
Olfr1132	A	G	2: 87,635,529	Y73H	probably damaging	Het
Olfr1264	A	G	2: 90,021,457	V203A	probably benign	Het
Olfr344	G	A	2: 36,569,341	V248I	probably damaging	Het
Ovgp1	A	C	3: 105,987,071		probably benign	Het
Pitpnm3	T	A	11: 72,071,487	Q230L	possibly damaging	Het
Pkn1	C	T	8: 83,670,293	V910I	probably benign	Het
Plcb1	T	A	2: 135,325,802		probably null	Het
Ppp1r12c	A	G	7: 4,482,789		probably null	Het
Rassf5	T	A	1: 131,244,814	Q106L	possibly damaging	Het
Rfc1	T	C	5: 65,312,979	K62E	possibly damaging	Het
Sf3b1	C	T	1: 55,019,395	E12K	probably damaging	Het
Slc4a1ap	A	T	5: 31,548,638	D691V	probably benign	Het
Speg	T	A	1: 75,422,757	F2283I	probably benign	Het
Synj2	A	G	17: 6,033,839	K267E	probably damaging	Het
Tg	A	T	15: 66,839,362	Y991F	probably damaging	Het
Tlk1	A	T	2: 70,742,083	D380E	probably benign	Het
Trim43b	A	T	9: 89,085,365	L405H	probably damaging	Het
Ttf2	A	G	3: 100,956,260	I586T	probably damaging	Het
Ugt2b36	T	A	5: 87,081,586	R213S	probably damaging	Het
Vmn1r198	T	A	13: 22,354,407	M21K	probably benign	Het
Wdr35	A	T	12: 8,978,685	Y101F	probably benign	Het
Zfp367	T	C	13: 64,144,250	Y189C	probably damaging	Het

Other mutations in Nol6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Nol6	APN	4	41123374	missense	possibly damaging	0.89
IGL00787:Nol6	APN	4	41122198	missense	probably benign	0.10
IGL01062:Nol6	APN	4	41118205	missense	probably benign	0.13
IGL01113:Nol6	APN	4	41115749	missense	probably damaging	1.00
IGL01874:Nol6	APN	4	41115412	missense	probably damaging	1.00
IGL01995:Nol6	APN	4	41118567	missense	probably damaging	1.00
IGL02060:Nol6	APN	4	41117700	missense	probably damaging	1.00
IGL03082:Nol6	APN	4	41115878	splice site	probably benign
IGL03221:Nol6	APN	4	41124166	missense	probably benign	0.00
IGL03332:Nol6	APN	4	41120735	missense	probably damaging	1.00
leaky	UTSW	4	41118154	missense	probably benign	0.02
R0066:Nol6	UTSW	4	41119572	splice site	probably benign
R0066:Nol6	UTSW	4	41119572	splice site	probably benign
R0308:Nol6	UTSW	4	41123584	missense	probably benign	0.01
R0632:Nol6	UTSW	4	41121115	missense	probably damaging	0.96
R1222:Nol6	UTSW	4	41120760	missense	probably benign	0.01
R1471:Nol6	UTSW	4	41120281	missense	probably benign	0.00
R1481:Nol6	UTSW	4	41123596	missense	probably benign	0.00
R1971:Nol6	UTSW	4	41119542	missense	probably damaging	1.00
R2191:Nol6	UTSW	4	41118720	missense	probably benign	0.00
R2495:Nol6	UTSW	4	41118427	missense	probably damaging	1.00
R3852:Nol6	UTSW	4	41117452	missense	probably damaging	0.99
R3923:Nol6	UTSW	4	41121531	missense	probably benign	0.17
R4458:Nol6	UTSW	4	41115888	missense	probably damaging	1.00
R4510:Nol6	UTSW	4	41123526	missense	probably damaging	1.00
R4511:Nol6	UTSW	4	41123526	missense	probably damaging	1.00
R4575:Nol6	UTSW	4	41120299	missense	probably benign	0.00
R4637:Nol6	UTSW	4	41121788	missense	probably damaging	0.99
R4700:Nol6	UTSW	4	41118944	missense	possibly damaging	0.58
R4820:Nol6	UTSW	4	41121508	missense	probably damaging	1.00
R4975:Nol6	UTSW	4	41120167	missense	probably benign	0.00
R5395:Nol6	UTSW	4	41118392	intron	probably benign
R5826:Nol6	UTSW	4	41122158	missense	probably benign	0.04
R6943:Nol6	UTSW	4	41118962	missense	probably damaging	1.00
R7001:Nol6	UTSW	4	41121279	missense	probably benign	0.00
R7035:Nol6	UTSW	4	41118479	missense	probably benign	0.01
R7282:Nol6	UTSW	4	41119468	missense	probably benign	0.18
R7327:Nol6	UTSW	4	41116686	missense	probably benign	0.34
R7402:Nol6	UTSW	4	41118699	missense	probably damaging	1.00
R7483:Nol6	UTSW	4	41117424	missense	possibly damaging	0.92
R7505:Nol6	UTSW	4	41120352	missense	probably damaging	1.00
R7669:Nol6	UTSW	4	41118717	missense	probably damaging	0.97
R8255:Nol6	UTSW	4	41120168	missense	probably benign	0.01
R8401:Nol6	UTSW	4	41119548	missense	possibly damaging	0.87
R8426:Nol6	UTSW	4	41119870	missense	probably benign	0.36
R8826:Nol6	UTSW	4	41121823	missense	probably benign	0.26
R9228:Nol6	UTSW	4	41116422	missense	probably benign	0.42
R9259:Nol6	UTSW	4	41118229	missense	possibly damaging	0.84
R9571:Nol6	UTSW	4	41120156	missense	probably benign	0.00
R9604:Nol6	UTSW	4	41120298	missense	probably benign	0.05
R9748:Nol6	UTSW	4	41123538	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAACGCCCGGAAGTTATTAC -3'
(R):5'- AGGAAGATAACTGTCGGTCGTG -3'

Sequencing Primer
(F):5'- TGTTACTACCAGTTCACAAGGGAG -3'
(R):5'- AAGATAACTGTCGGTCGTGGTCTG -3'

Posted On

2018-06-06