Incidental Mutation 'R6531:Slc4a1ap'
ID 522337
Institutional Source Beutler Lab
Gene Symbol Slc4a1ap
Ensembl Gene ENSMUSG00000029141
Gene Name solute carrier family 4 (anion exchanger), member 1, adaptor protein
Synonyms kanadaptin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.696) question?
Stock # R6531 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 31526995-31556932 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31548638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 691 (D691V)
Ref Sequence ENSEMBL: ENSMUSP00000144257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114533] [ENSMUST00000202214] [ENSMUST00000202950]
AlphaFold E9PX68
Predicted Effect probably benign
Transcript: ENSMUST00000114533
AA Change: D662V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110179
Gene: ENSMUSG00000029141
AA Change: D662V

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201789
AA Change: D26V
Predicted Effect unknown
Transcript: ENSMUST00000201925
AA Change: T110S
Predicted Effect probably benign
Transcript: ENSMUST00000202214
AA Change: D662V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144613
Gene: ENSMUSG00000029141
AA Change: D662V

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202273
AA Change: D81V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202575
Predicted Effect probably benign
Transcript: ENSMUST00000202950
AA Change: D691V

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144257
Gene: ENSMUSG00000029141
AA Change: D691V

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 1e-40 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Slc4a1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Slc4a1ap APN 5 31553777 missense probably damaging 1.00
IGL01526:Slc4a1ap APN 5 31528227 missense possibly damaging 0.86
R1556:Slc4a1ap UTSW 5 31534210 splice site probably null
R1694:Slc4a1ap UTSW 5 31543754 missense probably damaging 1.00
R1884:Slc4a1ap UTSW 5 31534180 missense probably damaging 1.00
R3787:Slc4a1ap UTSW 5 31528139 missense possibly damaging 0.92
R4510:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4511:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4562:Slc4a1ap UTSW 5 31532029 missense probably damaging 1.00
R4828:Slc4a1ap UTSW 5 31530709 nonsense probably null
R5611:Slc4a1ap UTSW 5 31553829 utr 3 prime probably benign
R5648:Slc4a1ap UTSW 5 31550785 splice site probably null
R5991:Slc4a1ap UTSW 5 31534069 missense possibly damaging 0.92
R6602:Slc4a1ap UTSW 5 31527641 missense probably damaging 1.00
R6770:Slc4a1ap UTSW 5 31527882 splice site probably null
R6844:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
R7103:Slc4a1ap UTSW 5 31543857 missense probably benign
R7342:Slc4a1ap UTSW 5 31536290 missense possibly damaging 0.89
R7378:Slc4a1ap UTSW 5 31527527 missense probably benign
R7527:Slc4a1ap UTSW 5 31534131 missense probably benign 0.04
R7603:Slc4a1ap UTSW 5 31546195 missense
R7608:Slc4a1ap UTSW 5 31536189 missense possibly damaging 0.51
R7781:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
R8867:Slc4a1ap UTSW 5 31550715 missense probably benign
R9083:Slc4a1ap UTSW 5 31527113 missense probably benign 0.00
R9109:Slc4a1ap UTSW 5 31536194 missense probably damaging 1.00
R9161:Slc4a1ap UTSW 5 31528130 missense
R9298:Slc4a1ap UTSW 5 31536194 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCTTAAGGTTATAGACAAGCC -3'
(R):5'- AGCCTGTAGGGTACATGAGC -3'

Sequencing Primer
(F):5'- CAAGCCAGTTACTGAGGTGTC -3'
(R):5'- CTGTAGGGTACATGAGCAGGGTAG -3'
Posted On 2018-06-06