Mutagenetix > Incidental Mutation

Incidental Mutation 'R6531:Rfc1'

522339

Institutional Source

Beutler Lab

Gene Symbol

Rfc1

Ensembl Gene

ENSMUSG00000029191

Gene Name

replication factor C (activator 1) 1

Synonyms

140kDa, Recc1, Alp145, RFC140

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6531 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65261850-65335670 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65312979 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 62 (K62E)

Ref Sequence

ENSEMBL: ENSMUSP00000134444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172732] [ENSMUST00000203471] [ENSMUST00000203581] [ENSMUST00000204965]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172732
AA Change: K62E

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000134444
Gene: ENSMUSG00000029191
AA Change: K62E

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	308	325	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
BRCT	401	479	7.39e-17	SMART
low complexity region	484	502	N/A	INTRINSIC
AAA	627	762	9.65e-10	SMART
Pfam:RFC1	899	1052	5.2e-62	PFAM
low complexity region	1104	1132	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197871

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203471
AA Change: K62E

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000144954
Gene: ENSMUSG00000029191
AA Change: K62E

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	308	325	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
BRCT	401	479	7.39e-17	SMART
low complexity region	484	502	N/A	INTRINSIC
AAA	627	762	9.65e-10	SMART
Pfam:RFC1	899	1052	2.5e-61	PFAM
low complexity region	1104	1132	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203581
AA Change: K62E

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000145385
Gene: ENSMUSG00000029191
AA Change: K62E

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	322	339	N/A	INTRINSIC
low complexity region	356	374	N/A	INTRINSIC
BRCT	415	493	7.39e-17	SMART
low complexity region	498	516	N/A	INTRINSIC
AAA	640	775	9.65e-10	SMART
Pfam:RFC1	912	1065	2.6e-61	PFAM
low complexity region	1117	1145	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203644

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204965
AA Change: K62E

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000144980
Gene: ENSMUSG00000029191
AA Change: K62E

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	308	325	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
BRCT	401	479	7.39e-17	SMART
low complexity region	484	502	N/A	INTRINSIC
AAA	627	762	9.65e-10	SMART
Pfam:RFC1	899	1052	2.5e-61	PFAM
low complexity region	1104	1131	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.2%
20x: 90.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of replication factor C, a five subunit DNA polymerase accessory protein, which is a DNA-dependent ATPase required for eukaryotic DNA replication and repair. The large subunit acts as an activator of DNA polymerases, binds to the 3' end of primers, and promotes coordinated synthesis of both strands. It may also have a role in telomere stability. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,949,999	E880G	possibly damaging	Het
Acsbg2	T	A	17: 56,846,617	I529F	probably damaging	Het
Ahcyl2	T	G	6: 29,886,162	M359R	probably benign	Het
Aldh5a1	G	T	13: 24,918,564	D305E	probably benign	Het
Catsper2	C	G	2: 121,399,780	V358L	possibly damaging	Het
Cd200r4	C	T	16: 44,833,505	Q222*	probably null	Het
Col4a2	T	A	8: 11,408,135	D270E	probably benign	Het
Cux1	T	C	5: 136,275,119	D1401G	probably benign	Het
Cyp3a59	T	A	5: 146,098,217	M235K	probably benign	Het
Dock3	T	C	9: 106,967,216	D895G	probably benign	Het
Dusp27	A	T	1: 166,110,046		probably null	Het
Dync1h1	T	C	12: 110,617,920	F586L	probably damaging	Het
Elmo1	G	T	13: 20,572,446	R568L	possibly damaging	Het
Epb41	T	C	4: 131,957,636	T711A	probably benign	Het
Grm7	T	A	6: 111,358,425	M599K	probably benign	Het
Hivep3	A	T	4: 120,122,876	K1704*	probably null	Het
Ighv1-62-3	C	A	12: 115,461,006	C115F	probably damaging	Het
Krt78	A	G	15: 101,952,273	Y200H	probably benign	Het
Lamb2	A	T	9: 108,483,726	H549L	possibly damaging	Het
Mroh3	A	G	1: 136,184,353	I759T	probably benign	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Nol6	G	T	4: 41,118,154	P828T	probably benign	Het
Olfr1030	A	G	2: 85,984,307	I156V	probably benign	Het
Olfr1132	A	G	2: 87,635,529	Y73H	probably damaging	Het
Olfr1264	A	G	2: 90,021,457	V203A	probably benign	Het
Olfr344	G	A	2: 36,569,341	V248I	probably damaging	Het
Ovgp1	A	C	3: 105,987,071		probably benign	Het
Pitpnm3	T	A	11: 72,071,487	Q230L	possibly damaging	Het
Pkn1	C	T	8: 83,670,293	V910I	probably benign	Het
Plcb1	T	A	2: 135,325,802		probably null	Het
Ppp1r12c	A	G	7: 4,482,789		probably null	Het
Rassf5	T	A	1: 131,244,814	Q106L	possibly damaging	Het
Sf3b1	C	T	1: 55,019,395	E12K	probably damaging	Het
Slc4a1ap	A	T	5: 31,548,638	D691V	probably benign	Het
Speg	T	A	1: 75,422,757	F2283I	probably benign	Het
Synj2	A	G	17: 6,033,839	K267E	probably damaging	Het
Tg	A	T	15: 66,839,362	Y991F	probably damaging	Het
Tlk1	A	T	2: 70,742,083	D380E	probably benign	Het
Trim43b	A	T	9: 89,085,365	L405H	probably damaging	Het
Ttf2	A	G	3: 100,956,260	I586T	probably damaging	Het
Ugt2b36	T	A	5: 87,081,586	R213S	probably damaging	Het
Vmn1r198	T	A	13: 22,354,407	M21K	probably benign	Het
Wdr35	A	T	12: 8,978,685	Y101F	probably benign	Het
Zfp367	T	C	13: 64,144,250	Y189C	probably damaging	Het

Other mutations in Rfc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Rfc1	APN	5	65296009	missense	probably benign	0.00
IGL00909:Rfc1	APN	5	65279699	missense	probably benign	0.00
IGL01791:Rfc1	APN	5	65263145	missense	probably benign	0.00
IGL01884:Rfc1	APN	5	65274460	missense	possibly damaging	0.94
IGL02737:Rfc1	APN	5	65311163	missense	possibly damaging	0.82
Disturbing	UTSW	5	65266162	missense	probably damaging	1.00
P0038:Rfc1	UTSW	5	65287961	missense	probably damaging	1.00
R0317:Rfc1	UTSW	5	65296052	splice site	probably null
R0452:Rfc1	UTSW	5	65264297	missense	probably benign	0.01
R0699:Rfc1	UTSW	5	65319399	splice site	probably null
R0945:Rfc1	UTSW	5	65278709	critical splice donor site	probably null
R1192:Rfc1	UTSW	5	65293911	missense	probably benign	0.03
R1341:Rfc1	UTSW	5	65291194	missense	probably damaging	1.00
R1425:Rfc1	UTSW	5	65319518	missense	probably damaging	1.00
R1551:Rfc1	UTSW	5	65277363	missense	probably damaging	0.99
R1800:Rfc1	UTSW	5	65264379	missense	probably damaging	1.00
R1969:Rfc1	UTSW	5	65319524	missense	probably damaging	1.00
R2006:Rfc1	UTSW	5	65311054	nonsense	probably null
R2026:Rfc1	UTSW	5	65288029	missense	probably damaging	1.00
R2073:Rfc1	UTSW	5	65301939	missense	probably damaging	0.98
R2137:Rfc1	UTSW	5	65311039	critical splice donor site	probably null
R2330:Rfc1	UTSW	5	65312969	missense	possibly damaging	0.94
R3774:Rfc1	UTSW	5	65264406	missense	probably damaging	1.00
R3787:Rfc1	UTSW	5	65296014	missense	probably benign	0.00
R4920:Rfc1	UTSW	5	65287928	missense	probably damaging	1.00
R5055:Rfc1	UTSW	5	65266162	missense	probably damaging	1.00
R5308:Rfc1	UTSW	5	65279461	missense	probably damaging	0.99
R5723:Rfc1	UTSW	5	65277426	missense	probably null	0.78
R5729:Rfc1	UTSW	5	65277452	missense	probably damaging	1.00
R5844:Rfc1	UTSW	5	65293787	missense	probably benign	0.19
R6045:Rfc1	UTSW	5	65279549	missense	probably damaging	1.00
R6484:Rfc1	UTSW	5	65293677	missense	probably benign	0.01
R6495:Rfc1	UTSW	5	65273815	splice site	probably null
R6717:Rfc1	UTSW	5	65302004	nonsense	probably null
R6717:Rfc1	UTSW	5	65312961	missense	probably damaging	0.97
R6845:Rfc1	UTSW	5	65311116	missense	possibly damaging	0.53
R6880:Rfc1	UTSW	5	65277386	missense	probably benign	0.14
R7329:Rfc1	UTSW	5	65263135	missense	unknown
R7331:Rfc1	UTSW	5	65311044	missense	probably damaging	1.00
R7466:Rfc1	UTSW	5	65275426	missense	probably damaging	1.00
R7497:Rfc1	UTSW	5	65279498	missense	probably damaging	1.00
R7588:Rfc1	UTSW	5	65272507	missense	probably damaging	1.00
R8020:Rfc1	UTSW	5	65272178	missense	probably damaging	1.00
R8056:Rfc1	UTSW	5	65294093	intron	probably benign
R8282:Rfc1	UTSW	5	65268946	critical splice donor site	probably null
R8316:Rfc1	UTSW	5	65278734	missense	probably benign	0.05
R8320:Rfc1	UTSW	5	65303036	nonsense	probably null
R8865:Rfc1	UTSW	5	65278792	missense	possibly damaging	0.89
R8968:Rfc1	UTSW	5	65275435	missense	probably benign	0.03
R8997:Rfc1	UTSW	5	65275721	missense	probably damaging	1.00
R9454:Rfc1	UTSW	5	65274431	missense
R9476:Rfc1	UTSW	5	65279799	missense	probably damaging	0.99
R9631:Rfc1	UTSW	5	65272508	missense	probably damaging	1.00
R9758:Rfc1	UTSW	5	65302048	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGCGCTGACAACTGTTCC -3'
(R):5'- TGCGTGATGTTAGTAGTACCC -3'

Sequencing Primer
(F):5'- GCTGACAACTGTTCCAAGGAC -3'
(R):5'- AGTAGTACCCTTATGTACTCTAGGTG -3'

Posted On

2018-06-06