Incidental Mutation 'R6531:Ahcyl2'
ID 522345
Institutional Source Beutler Lab
Gene Symbol Ahcyl2
Ensembl Gene ENSMUSG00000029772
Gene Name S-adenosylhomocysteine hydrolase-like 2
Synonyms 4631427C17Rik
MMRRC Submission 044657-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.574) question?
Stock # R6531 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 29768378-29912309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 29886161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 359 (M359R)
Ref Sequence ENSEMBL: ENSMUSP00000110897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064872] [ENSMUST00000102995] [ENSMUST00000115238] [ENSMUST00000115242] [ENSMUST00000125911] [ENSMUST00000128927] [ENSMUST00000134438] [ENSMUST00000143091]
AlphaFold Q68FL4
Predicted Effect probably benign
Transcript: ENSMUST00000064872
AA Change: M254R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000067638
Gene: ENSMUSG00000029772
AA Change: M254R

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102995
AA Change: M358R

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100060
Gene: ENSMUSG00000029772
AA Change: M358R

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 142 172 N/A INTRINSIC
AdoHcyase 186 611 4.47e-268 SMART
AdoHcyase_NAD 371 532 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115238
AA Change: M254R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110893
Gene: ENSMUSG00000029772
AA Change: M254R

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115242
AA Change: M359R

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110897
Gene: ENSMUSG00000029772
AA Change: M359R

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 143 173 N/A INTRINSIC
AdoHcyase 187 612 4.47e-268 SMART
AdoHcyase_NAD 372 533 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125911
AA Change: M150R

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000135518
Gene: ENSMUSG00000029772
AA Change: M150R

DomainStartEndE-ValueType
AdoHcyase 1 403 8.07e-243 SMART
AdoHcyase_NAD 163 324 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128927
SMART Domains Protein: ENSMUSP00000135633
Gene: ENSMUSG00000029772

DomainStartEndE-ValueType
low complexity region 39 69 N/A INTRINSIC
Pfam:AdoHcyase 82 223 3.5e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149816
Predicted Effect probably benign
Transcript: ENSMUST00000134438
SMART Domains Protein: ENSMUSP00000118790
Gene: ENSMUSG00000029772

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 56 86 N/A INTRINSIC
Pfam:AdoHcyase 99 238 1.1e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143091
SMART Domains Protein: ENSMUSP00000144873
Gene: ENSMUSG00000029772

DomainStartEndE-ValueType
Pfam:AdoHcyase 1 115 2.1e-54 PFAM
Meta Mutation Damage Score 0.8487 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,926,980 (GRCm39) E880G possibly damaging Het
Acsbg2 T A 17: 57,153,617 (GRCm39) I529F probably damaging Het
Aldh5a1 G T 13: 25,102,547 (GRCm39) D305E probably benign Het
Catsper2 C G 2: 121,230,261 (GRCm39) V358L possibly damaging Het
Cd200r4 C T 16: 44,653,868 (GRCm39) Q222* probably null Het
Col4a2 T A 8: 11,458,135 (GRCm39) D270E probably benign Het
Cux1 T C 5: 136,303,973 (GRCm39) D1401G probably benign Het
Cyp3a59 T A 5: 146,035,027 (GRCm39) M235K probably benign Het
Dock3 T C 9: 106,844,415 (GRCm39) D895G probably benign Het
Dync1h1 T C 12: 110,584,354 (GRCm39) F586L probably damaging Het
Elmo1 G T 13: 20,756,616 (GRCm39) R568L possibly damaging Het
Epb41 T C 4: 131,684,947 (GRCm39) T711A probably benign Het
Grm7 T A 6: 111,335,386 (GRCm39) M599K probably benign Het
Hivep3 A T 4: 119,980,073 (GRCm39) K1704* probably null Het
Ighv1-62-3 C A 12: 115,424,626 (GRCm39) C115F probably damaging Het
Krt78 A G 15: 101,860,708 (GRCm39) Y200H probably benign Het
Lamb2 A T 9: 108,360,925 (GRCm39) H549L possibly damaging Het
Mroh3 A G 1: 136,112,091 (GRCm39) I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,775,161 (GRCm39) probably null Het
Nol6 G T 4: 41,118,154 (GRCm39) P828T probably benign Het
Or1j15 G A 2: 36,459,353 (GRCm39) V248I probably damaging Het
Or4c3 A G 2: 89,851,801 (GRCm39) V203A probably benign Het
Or5m5 A G 2: 85,814,651 (GRCm39) I156V probably benign Het
Or8w1 A G 2: 87,465,873 (GRCm39) Y73H probably damaging Het
Ovgp1 A C 3: 105,894,387 (GRCm39) probably benign Het
Pitpnm3 T A 11: 71,962,313 (GRCm39) Q230L possibly damaging Het
Pkn1 C T 8: 84,396,922 (GRCm39) V910I probably benign Het
Plcb1 T A 2: 135,167,722 (GRCm39) probably null Het
Ppp1r12c A G 7: 4,485,788 (GRCm39) probably null Het
Rassf5 T A 1: 131,172,551 (GRCm39) Q106L possibly damaging Het
Rfc1 T C 5: 65,470,322 (GRCm39) K62E possibly damaging Het
Sf3b1 C T 1: 55,058,554 (GRCm39) E12K probably damaging Het
Slc4a1ap A T 5: 31,705,982 (GRCm39) D691V probably benign Het
Speg T A 1: 75,399,401 (GRCm39) F2283I probably benign Het
Styxl2 A T 1: 165,937,615 (GRCm39) probably null Het
Synj2 A G 17: 6,084,114 (GRCm39) K267E probably damaging Het
Tg A T 15: 66,711,211 (GRCm39) Y991F probably damaging Het
Tlk1 A T 2: 70,572,427 (GRCm39) D380E probably benign Het
Trim43b A T 9: 88,967,418 (GRCm39) L405H probably damaging Het
Ttf2 A G 3: 100,863,576 (GRCm39) I586T probably damaging Het
Ugt2b36 T A 5: 87,229,445 (GRCm39) R213S probably damaging Het
Vmn1r198 T A 13: 22,538,577 (GRCm39) M21K probably benign Het
Wdr35 A T 12: 9,028,685 (GRCm39) Y101F probably benign Het
Zfp367 T C 13: 64,292,064 (GRCm39) Y189C probably damaging Het
Other mutations in Ahcyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Ahcyl2 APN 6 29,880,556 (GRCm39) missense probably benign 0.03
IGL03072:Ahcyl2 APN 6 29,906,500 (GRCm39) splice site probably benign
IGL03195:Ahcyl2 APN 6 29,906,768 (GRCm39) splice site probably benign
R0189:Ahcyl2 UTSW 6 29,891,242 (GRCm39) missense probably benign 0.32
R0395:Ahcyl2 UTSW 6 29,886,167 (GRCm39) missense probably damaging 1.00
R0555:Ahcyl2 UTSW 6 29,890,670 (GRCm39) critical splice acceptor site probably benign
R0924:Ahcyl2 UTSW 6 29,870,627 (GRCm39) splice site probably null
R0930:Ahcyl2 UTSW 6 29,870,627 (GRCm39) splice site probably null
R1413:Ahcyl2 UTSW 6 29,768,586 (GRCm39) utr 5 prime probably benign
R1446:Ahcyl2 UTSW 6 29,891,239 (GRCm39) missense probably damaging 0.96
R1822:Ahcyl2 UTSW 6 29,768,583 (GRCm39) utr 5 prime probably benign
R1864:Ahcyl2 UTSW 6 29,908,354 (GRCm39) missense probably damaging 1.00
R1865:Ahcyl2 UTSW 6 29,908,354 (GRCm39) missense probably damaging 1.00
R3810:Ahcyl2 UTSW 6 29,891,260 (GRCm39) missense probably benign 0.01
R4429:Ahcyl2 UTSW 6 29,894,874 (GRCm39) missense probably damaging 1.00
R4932:Ahcyl2 UTSW 6 29,890,700 (GRCm39) missense probably benign 0.22
R5019:Ahcyl2 UTSW 6 29,859,738 (GRCm39) missense possibly damaging 0.96
R5032:Ahcyl2 UTSW 6 29,768,555 (GRCm39) utr 5 prime probably benign
R5396:Ahcyl2 UTSW 6 29,859,697 (GRCm39) intron probably benign
R5604:Ahcyl2 UTSW 6 29,908,366 (GRCm39) missense probably damaging 1.00
R5817:Ahcyl2 UTSW 6 29,890,720 (GRCm39) missense probably damaging 1.00
R5959:Ahcyl2 UTSW 6 29,886,173 (GRCm39) missense probably damaging 1.00
R6159:Ahcyl2 UTSW 6 29,908,457 (GRCm39) missense possibly damaging 0.81
R7025:Ahcyl2 UTSW 6 29,908,420 (GRCm39) missense probably damaging 1.00
R7478:Ahcyl2 UTSW 6 29,903,266 (GRCm39) missense probably damaging 1.00
R7560:Ahcyl2 UTSW 6 29,886,139 (GRCm39) missense probably damaging 1.00
R7604:Ahcyl2 UTSW 6 29,768,555 (GRCm39) missense unknown
R7960:Ahcyl2 UTSW 6 29,870,626 (GRCm39) missense probably benign 0.39
R7969:Ahcyl2 UTSW 6 29,870,663 (GRCm39) missense probably damaging 1.00
R8046:Ahcyl2 UTSW 6 29,878,619 (GRCm39) missense probably damaging 1.00
R8360:Ahcyl2 UTSW 6 29,768,869 (GRCm39) missense probably benign
R9432:Ahcyl2 UTSW 6 29,768,874 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GAGCTTTATTGCCAGGCTGG -3'
(R):5'- GGTGTGATGTGGTTAAACATGAAAC -3'

Sequencing Primer
(F):5'- TCTCTGTATCTGTCTTGTAGGATG -3'
(R):5'- GTGGTTAAACATGAAACAGTTCCAG -3'
Posted On 2018-06-06