Mutagenetix > Incidental Mutations

Incidental Mutation 'R6564:H2afx'

522348

Institutional Source

Beutler Lab

Gene Symbol

H2afx

Ensembl Gene

ENSMUSG00000049932

Gene Name

H2A histone family, member X

Synonyms

H2A.X, gammaH2ax, H2ax, Hist5-2ax

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.846) question?

Stock #

R6564 (G1)

Quality Score

219.009

Status

Validated

Chromosome

Chromosomal Location

44334694-44336077 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44334912 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 51 (Y51H)

Ref Sequence

ENSEMBL: ENSMUSP00000051432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052686] [ENSMUST00000054708] [ENSMUST00000077353] [ENSMUST00000097558] [ENSMUST00000215050] [ENSMUST00000216852]

Predicted Effect

probably damaging
Transcript: ENSMUST00000052686
AA Change: Y51H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051432
Gene: ENSMUSG00000049932
AA Change: Y51H

Domain	Start	End	E-Value	Type
H2A	3	123	1.64e-81	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000054708

SMART Domains

Protein: ENSMUSP00000056282
Gene: ENSMUSG00000032123

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
Pfam:Glycos_transf_4	100	272	1.1e-38	PFAM
transmembrane domain	277	299	N/A	INTRINSIC
transmembrane domain	381	403	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000077353

SMART Domains

Protein: ENSMUSP00000076575
Gene: ENSMUSG00000032126

Domain	Start	End	E-Value	Type
Pfam:Porphobil_deam	21	233	1.7e-79	PFAM
Pfam:Porphobil_deamC	244	323	6.8e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097558

SMART Domains

Protein: ENSMUSP00000095166
Gene: ENSMUSG00000032126

Domain	Start	End	E-Value	Type
Pfam:Porphobil_deam	3	219	3.9e-95	PFAM
Pfam:Porphobil_deamC	227	327	4.7e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196879

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213461

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213709

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214012

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214967

Predicted Effect

probably benign
Transcript: ENSMUST00000215050

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215859

Predicted Effect

probably benign
Transcript: ENSMUST00000216658

Predicted Effect

probably benign
Transcript: ENSMUST00000216852

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,486,077		probably null	Het
4931429L15Rik	C	A	9: 46,306,904	D179Y	probably damaging	Het
Abca1	A	T	4: 53,034,031	L2233Q	possibly damaging	Het
Abca12	T	A	1: 71,309,850	E834V	possibly damaging	Het
Abcc9	T	C	6: 142,603,108	Y1318C	probably damaging	Het
Adam15	C	A	3: 89,347,212	R121L	possibly damaging	Het
Afdn	T	A	17: 13,896,089	M1588K	probably benign	Het
Akap9	T	C	5: 4,028,491	S1849P	probably damaging	Het
Bag6	T	C	17: 35,140,371	S213P	probably damaging	Het
Bpifb9a	T	C	2: 154,260,178	V65A	probably benign	Het
Chn1	T	A	2: 73,618,041	I203F	probably damaging	Het
Crnkl1	T	A	2: 145,928,245	E226V	possibly damaging	Het
Cspg4	A	G	9: 56,890,158	E1302G	probably benign	Het
Dnah5	G	T	15: 28,367,745	A2759S	probably benign	Het
Doxl2	T	C	6: 48,977,575	V549A	probably benign	Het
Dtx1	T	A	5: 120,695,017	T119S	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ezr	C	T	17: 6,742,847	V268M	probably damaging	Het
Fbxl15	T	C	19: 46,329,338	V153A	probably damaging	Het
Fkbpl	C	A	17: 34,646,266	A336E	probably benign	Het
Gsg1l2	A	G	11: 67,786,504	T200A	possibly damaging	Het
Ifi213	A	C	1: 173,595,296	M1R	probably null	Het
Kcnt1	A	C	2: 25,911,051	D1045A	probably benign	Het
Kdm4a	C	A	4: 118,177,439	A32S	probably benign	Het
Klkb1	A	T	8: 45,273,634	V444E	probably damaging	Het
Mccc1	T	C	3: 35,976,676	T414A	probably damaging	Het
Miga1	A	C	3: 152,285,322	N367K	probably damaging	Het
Mmp7	A	G	9: 7,695,184	D49G	probably benign	Het
Nlrp1a	A	G	11: 71,123,572	L284P	probably damaging	Het
Olfr1411	T	C	1: 92,596,563	S15P	probably benign	Het
Olfr853	G	A	9: 19,537,210	T240I	possibly damaging	Het
Pbld1	T	A	10: 63,072,027	I224N	possibly damaging	Het
Pih1d1	A	T	7: 45,159,819	R276W	probably damaging	Het
Plekhg1	G	T	10: 3,964,153	V1292L	probably damaging	Het
Prex2	A	G	1: 11,101,061		probably null	Het
Rbm6	T	C	9: 107,833,498	Y498C	probably damaging	Het
Reps1	T	A	10: 18,122,392		probably null	Het
Ruvbl1	T	A	6: 88,479,226	I154N	possibly damaging	Het
Slc4a5	T	G	6: 83,280,060	F616V	possibly damaging	Het
Spag5	A	T	11: 78,315,575	T798S	probably damaging	Het
Spam1	T	A	6: 24,796,356	I102K	possibly damaging	Het
Sptbn2	C	A	19: 4,732,024	F430L	probably damaging	Het
Svs3a	T	A	2: 164,289,350	I21K	probably damaging	Het
Tet3	T	A	6: 83,386,070	I842L	possibly damaging	Het
Tlr2	T	A	3: 83,837,695	K360N	probably benign	Het
Tmem45b	C	G	9: 31,428,005	W138S	probably damaging	Het
Tpgs2	T	C	18: 25,158,287	E40G	probably damaging	Het
Traj40	T	C	14: 54,177,942		probably benign	Het
Trpm5	A	G	7: 143,072,770	S125P	probably damaging	Het
Ttc3	G	T	16: 94,442,611	C1158F	probably damaging	Het
Tubg1	T	C	11: 101,120,889	I74T	probably damaging	Het
Vav2	A	T	2: 27,279,185		probably null	Het
Wbp4	G	T	14: 79,467,428	H201N	probably damaging	Het
Wdhd1	A	G	14: 47,248,042	S821P	probably benign	Het
Wsb2	A	T	5: 117,370,560		probably null	Het
Zic5	A	G	14: 122,459,421	L594P	unknown	Het

Other mutations in H2afx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01808:H2afx	APN	9	44334949	missense	possibly damaging	0.94
R5506:H2afx	UTSW	9	44335105	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAGTTCGTGGTCTCTCAGCG -3'
(R):5'- TAAAAGGGCCTTTGTGGAGG -3'

Sequencing Primer
(F):5'- CGTGGTCTCTCAGCGTTGTTC -3'
(R):5'- TCAGTACTCCTGAGAGGCCTG -3'

Posted On

2018-06-06