Incidental Mutation 'R6564:H2afx'
ID522348
Institutional Source Beutler Lab
Gene Symbol H2afx
Ensembl Gene ENSMUSG00000049932
Gene NameH2A histone family, member X
SynonymsH2A.X, gammaH2ax, H2ax, Hist5-2ax
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R6564 (G1)
Quality Score219.009
Status Validated
Chromosome9
Chromosomal Location44334694-44336077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44334912 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 51 (Y51H)
Ref Sequence ENSEMBL: ENSMUSP00000051432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052686] [ENSMUST00000054708] [ENSMUST00000077353] [ENSMUST00000097558] [ENSMUST00000215050] [ENSMUST00000216852]
Predicted Effect probably damaging
Transcript: ENSMUST00000052686
AA Change: Y51H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051432
Gene: ENSMUSG00000049932
AA Change: Y51H

DomainStartEndE-ValueType
H2A 3 123 1.64e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054708
SMART Domains Protein: ENSMUSP00000056282
Gene: ENSMUSG00000032123

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Glycos_transf_4 100 272 1.1e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
transmembrane domain 381 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077353
SMART Domains Protein: ENSMUSP00000076575
Gene: ENSMUSG00000032126

DomainStartEndE-ValueType
Pfam:Porphobil_deam 21 233 1.7e-79 PFAM
Pfam:Porphobil_deamC 244 323 6.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097558
SMART Domains Protein: ENSMUSP00000095166
Gene: ENSMUSG00000032126

DomainStartEndE-ValueType
Pfam:Porphobil_deam 3 219 3.9e-95 PFAM
Pfam:Porphobil_deamC 227 327 4.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214967
Predicted Effect probably benign
Transcript: ENSMUST00000215050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215859
Predicted Effect probably benign
Transcript: ENSMUST00000216658
Predicted Effect probably benign
Transcript: ENSMUST00000216852
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,486,077 probably null Het
4931429L15Rik C A 9: 46,306,904 D179Y probably damaging Het
Abca1 A T 4: 53,034,031 L2233Q possibly damaging Het
Abca12 T A 1: 71,309,850 E834V possibly damaging Het
Abcc9 T C 6: 142,603,108 Y1318C probably damaging Het
Adam15 C A 3: 89,347,212 R121L possibly damaging Het
Afdn T A 17: 13,896,089 M1588K probably benign Het
Akap9 T C 5: 4,028,491 S1849P probably damaging Het
Bag6 T C 17: 35,140,371 S213P probably damaging Het
Bpifb9a T C 2: 154,260,178 V65A probably benign Het
Chn1 T A 2: 73,618,041 I203F probably damaging Het
Crnkl1 T A 2: 145,928,245 E226V possibly damaging Het
Cspg4 A G 9: 56,890,158 E1302G probably benign Het
Dnah5 G T 15: 28,367,745 A2759S probably benign Het
Doxl2 T C 6: 48,977,575 V549A probably benign Het
Dtx1 T A 5: 120,695,017 T119S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ezr C T 17: 6,742,847 V268M probably damaging Het
Fbxl15 T C 19: 46,329,338 V153A probably damaging Het
Fkbpl C A 17: 34,646,266 A336E probably benign Het
Gsg1l2 A G 11: 67,786,504 T200A possibly damaging Het
Ifi213 A C 1: 173,595,296 M1R probably null Het
Kcnt1 A C 2: 25,911,051 D1045A probably benign Het
Kdm4a C A 4: 118,177,439 A32S probably benign Het
Klkb1 A T 8: 45,273,634 V444E probably damaging Het
Mccc1 T C 3: 35,976,676 T414A probably damaging Het
Miga1 A C 3: 152,285,322 N367K probably damaging Het
Mmp7 A G 9: 7,695,184 D49G probably benign Het
Nlrp1a A G 11: 71,123,572 L284P probably damaging Het
Olfr1411 T C 1: 92,596,563 S15P probably benign Het
Olfr853 G A 9: 19,537,210 T240I possibly damaging Het
Pbld1 T A 10: 63,072,027 I224N possibly damaging Het
Pih1d1 A T 7: 45,159,819 R276W probably damaging Het
Plekhg1 G T 10: 3,964,153 V1292L probably damaging Het
Prex2 A G 1: 11,101,061 probably null Het
Rbm6 T C 9: 107,833,498 Y498C probably damaging Het
Reps1 T A 10: 18,122,392 probably null Het
Ruvbl1 T A 6: 88,479,226 I154N possibly damaging Het
Slc4a5 T G 6: 83,280,060 F616V possibly damaging Het
Spag5 A T 11: 78,315,575 T798S probably damaging Het
Spam1 T A 6: 24,796,356 I102K possibly damaging Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svs3a T A 2: 164,289,350 I21K probably damaging Het
Tet3 T A 6: 83,386,070 I842L possibly damaging Het
Tlr2 T A 3: 83,837,695 K360N probably benign Het
Tmem45b C G 9: 31,428,005 W138S probably damaging Het
Tpgs2 T C 18: 25,158,287 E40G probably damaging Het
Traj40 T C 14: 54,177,942 probably benign Het
Trpm5 A G 7: 143,072,770 S125P probably damaging Het
Ttc3 G T 16: 94,442,611 C1158F probably damaging Het
Tubg1 T C 11: 101,120,889 I74T probably damaging Het
Vav2 A T 2: 27,279,185 probably null Het
Wbp4 G T 14: 79,467,428 H201N probably damaging Het
Wdhd1 A G 14: 47,248,042 S821P probably benign Het
Wsb2 A T 5: 117,370,560 probably null Het
Zic5 A G 14: 122,459,421 L594P unknown Het
Other mutations in H2afx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:H2afx APN 9 44334949 missense possibly damaging 0.94
R5506:H2afx UTSW 9 44335105 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTTCGTGGTCTCTCAGCG -3'
(R):5'- TAAAAGGGCCTTTGTGGAGG -3'

Sequencing Primer
(F):5'- CGTGGTCTCTCAGCGTTGTTC -3'
(R):5'- TCAGTACTCCTGAGAGGCCTG -3'
Posted On2018-06-06