Incidental Mutation 'R6531:Ppp1r12c'
ID 522351
Institutional Source Beutler Lab
Gene Symbol Ppp1r12c
Ensembl Gene ENSMUSG00000019254
Gene Name protein phosphatase 1, regulatory subunit 12C
Synonyms Mbs85, 2410197A17Rik
MMRRC Submission 044657-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R6531 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 4484519-4504679 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 4485788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013886] [ENSMUST00000086372] [ENSMUST00000124248] [ENSMUST00000163893] [ENSMUST00000171445] [ENSMUST00000164987] [ENSMUST00000163137]
AlphaFold Q3UMT1
Predicted Effect probably null
Transcript: ENSMUST00000013886
SMART Domains Protein: ENSMUSP00000013886
Gene: ENSMUSG00000019254

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 74 97 N/A INTRINSIC
ANK 104 133 3.71e-4 SMART
ANK 137 166 3.43e-8 SMART
low complexity region 205 210 N/A INTRINSIC
ANK 230 259 7.95e-4 SMART
ANK 263 292 2.41e-3 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 401 413 N/A INTRINSIC
internal_repeat_2 450 508 2.86e-5 PROSPERO
internal_repeat_2 545 599 2.86e-5 PROSPERO
low complexity region 631 649 N/A INTRINSIC
Pfam:PRKG1_interact 682 782 9.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086372
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124248
SMART Domains Protein: ENSMUSP00000120029
Gene: ENSMUSG00000019254

DomainStartEndE-ValueType
ANK 25 54 3.71e-4 SMART
ANK 58 87 3.43e-8 SMART
low complexity region 126 131 N/A INTRINSIC
ANK 151 180 7.95e-4 SMART
ANK 184 213 2.41e-3 SMART
low complexity region 290 306 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:2KJY|A 445 498 3e-11 PDB
low complexity region 553 571 N/A INTRINSIC
coiled coil region 604 704 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147679
Predicted Effect probably benign
Transcript: ENSMUST00000163893
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171445
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168924
Predicted Effect probably benign
Transcript: ENSMUST00000164987
SMART Domains Protein: ENSMUSP00000130665
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
low complexity region 15 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163137
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153101
Meta Mutation Damage Score 0.9578 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a subunit of myosin phosphatase. The encoded protein regulates the catalytic activity of protein phosphatase 1 delta and assembly of the actin cytoskeleton. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,926,980 (GRCm39) E880G possibly damaging Het
Acsbg2 T A 17: 57,153,617 (GRCm39) I529F probably damaging Het
Ahcyl2 T G 6: 29,886,161 (GRCm39) M359R probably benign Het
Aldh5a1 G T 13: 25,102,547 (GRCm39) D305E probably benign Het
Catsper2 C G 2: 121,230,261 (GRCm39) V358L possibly damaging Het
Cd200r4 C T 16: 44,653,868 (GRCm39) Q222* probably null Het
Col4a2 T A 8: 11,458,135 (GRCm39) D270E probably benign Het
Cux1 T C 5: 136,303,973 (GRCm39) D1401G probably benign Het
Cyp3a59 T A 5: 146,035,027 (GRCm39) M235K probably benign Het
Dock3 T C 9: 106,844,415 (GRCm39) D895G probably benign Het
Dync1h1 T C 12: 110,584,354 (GRCm39) F586L probably damaging Het
Elmo1 G T 13: 20,756,616 (GRCm39) R568L possibly damaging Het
Epb41 T C 4: 131,684,947 (GRCm39) T711A probably benign Het
Grm7 T A 6: 111,335,386 (GRCm39) M599K probably benign Het
Hivep3 A T 4: 119,980,073 (GRCm39) K1704* probably null Het
Ighv1-62-3 C A 12: 115,424,626 (GRCm39) C115F probably damaging Het
Krt78 A G 15: 101,860,708 (GRCm39) Y200H probably benign Het
Lamb2 A T 9: 108,360,925 (GRCm39) H549L possibly damaging Het
Mroh3 A G 1: 136,112,091 (GRCm39) I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,775,161 (GRCm39) probably null Het
Nol6 G T 4: 41,118,154 (GRCm39) P828T probably benign Het
Or1j15 G A 2: 36,459,353 (GRCm39) V248I probably damaging Het
Or4c3 A G 2: 89,851,801 (GRCm39) V203A probably benign Het
Or5m5 A G 2: 85,814,651 (GRCm39) I156V probably benign Het
Or8w1 A G 2: 87,465,873 (GRCm39) Y73H probably damaging Het
Ovgp1 A C 3: 105,894,387 (GRCm39) probably benign Het
Pitpnm3 T A 11: 71,962,313 (GRCm39) Q230L possibly damaging Het
Pkn1 C T 8: 84,396,922 (GRCm39) V910I probably benign Het
Plcb1 T A 2: 135,167,722 (GRCm39) probably null Het
Rassf5 T A 1: 131,172,551 (GRCm39) Q106L possibly damaging Het
Rfc1 T C 5: 65,470,322 (GRCm39) K62E possibly damaging Het
Sf3b1 C T 1: 55,058,554 (GRCm39) E12K probably damaging Het
Slc4a1ap A T 5: 31,705,982 (GRCm39) D691V probably benign Het
Speg T A 1: 75,399,401 (GRCm39) F2283I probably benign Het
Styxl2 A T 1: 165,937,615 (GRCm39) probably null Het
Synj2 A G 17: 6,084,114 (GRCm39) K267E probably damaging Het
Tg A T 15: 66,711,211 (GRCm39) Y991F probably damaging Het
Tlk1 A T 2: 70,572,427 (GRCm39) D380E probably benign Het
Trim43b A T 9: 88,967,418 (GRCm39) L405H probably damaging Het
Ttf2 A G 3: 100,863,576 (GRCm39) I586T probably damaging Het
Ugt2b36 T A 5: 87,229,445 (GRCm39) R213S probably damaging Het
Vmn1r198 T A 13: 22,538,577 (GRCm39) M21K probably benign Het
Wdr35 A T 12: 9,028,685 (GRCm39) Y101F probably benign Het
Zfp367 T C 13: 64,292,064 (GRCm39) Y189C probably damaging Het
Other mutations in Ppp1r12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ppp1r12c APN 7 4,500,344 (GRCm39) splice site probably benign
IGL01419:Ppp1r12c APN 7 4,489,351 (GRCm39) splice site probably null
IGL02126:Ppp1r12c APN 7 4,492,858 (GRCm39) missense probably benign 0.43
IGL03388:Ppp1r12c APN 7 4,485,069 (GRCm39) unclassified probably benign
PIT4418001:Ppp1r12c UTSW 7 4,504,266 (GRCm39) missense probably null 0.09
R0523:Ppp1r12c UTSW 7 4,492,771 (GRCm39) missense probably damaging 1.00
R0815:Ppp1r12c UTSW 7 4,489,365 (GRCm39) missense probably damaging 1.00
R0863:Ppp1r12c UTSW 7 4,489,365 (GRCm39) missense probably damaging 1.00
R1413:Ppp1r12c UTSW 7 4,487,443 (GRCm39) splice site probably null
R1522:Ppp1r12c UTSW 7 4,500,424 (GRCm39) missense probably damaging 1.00
R1835:Ppp1r12c UTSW 7 4,486,650 (GRCm39) missense probably damaging 1.00
R2004:Ppp1r12c UTSW 7 4,485,974 (GRCm39) nonsense probably null
R2170:Ppp1r12c UTSW 7 4,485,805 (GRCm39) missense possibly damaging 0.76
R3787:Ppp1r12c UTSW 7 4,489,583 (GRCm39) missense probably damaging 1.00
R3833:Ppp1r12c UTSW 7 4,485,785 (GRCm39) unclassified probably benign
R4093:Ppp1r12c UTSW 7 4,486,366 (GRCm39) missense probably damaging 0.99
R4095:Ppp1r12c UTSW 7 4,486,366 (GRCm39) missense probably damaging 0.99
R4108:Ppp1r12c UTSW 7 4,489,565 (GRCm39) missense probably damaging 1.00
R5177:Ppp1r12c UTSW 7 4,487,495 (GRCm39) nonsense probably null
R5319:Ppp1r12c UTSW 7 4,486,983 (GRCm39) missense probably benign 0.01
R5561:Ppp1r12c UTSW 7 4,489,355 (GRCm39) critical splice donor site probably null
R5739:Ppp1r12c UTSW 7 4,500,281 (GRCm39) missense probably damaging 1.00
R5837:Ppp1r12c UTSW 7 4,500,403 (GRCm39) intron probably benign
R7207:Ppp1r12c UTSW 7 4,492,867 (GRCm39) missense probably damaging 1.00
R7507:Ppp1r12c UTSW 7 4,486,970 (GRCm39) missense probably benign 0.01
R7920:Ppp1r12c UTSW 7 4,486,354 (GRCm39) missense probably benign 0.00
R7934:Ppp1r12c UTSW 7 4,488,416 (GRCm39) nonsense probably null
R8391:Ppp1r12c UTSW 7 4,500,431 (GRCm39) missense probably damaging 1.00
R8397:Ppp1r12c UTSW 7 4,492,768 (GRCm39) missense probably damaging 0.98
R8793:Ppp1r12c UTSW 7 4,485,887 (GRCm39) missense probably benign
R8851:Ppp1r12c UTSW 7 4,487,703 (GRCm39) missense probably damaging 1.00
R8974:Ppp1r12c UTSW 7 4,486,698 (GRCm39) missense probably damaging 1.00
R9114:Ppp1r12c UTSW 7 4,485,792 (GRCm39) missense possibly damaging 0.83
Z1177:Ppp1r12c UTSW 7 4,487,628 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CAACACACTTATACCTGCGTGG -3'
(R):5'- CAGGTAGACTGGGTCATGTG -3'

Sequencing Primer
(F):5'- ACCTTGAGCTGTGCCAGAC -3'
(R):5'- GTGGAGGCTGGGACACATTTC -3'
Posted On 2018-06-06