Incidental Mutation 'R6531:Pkn1'
ID 522355
Institutional Source Beutler Lab
Gene Symbol Pkn1
Ensembl Gene ENSMUSG00000057672
Gene Name protein kinase N1
Synonyms PRK1, F730027O18Rik, PAK1, Prkcl1, Pkn, Stk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6531 (G1)
Quality Score 181.009
Status Validated
Chromosome 8
Chromosomal Location 83666536-83699179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83670293 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 910 (V910I)
Ref Sequence ENSEMBL: ENSMUSP00000116235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005616] [ENSMUST00000019608] [ENSMUST00000132945] [ENSMUST00000144258]
AlphaFold P70268
Predicted Effect probably benign
Transcript: ENSMUST00000005616
AA Change: V905I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000005616
Gene: ENSMUSG00000057672
AA Change: V905I

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Hr1 37 101 6.74e-20 SMART
Hr1 126 194 1.13e-21 SMART
Hr1 216 284 7.79e-25 SMART
C2 328 464 2.45e-1 SMART
low complexity region 569 601 N/A INTRINSIC
S_TKc 619 878 2.83e-96 SMART
S_TK_X 879 943 5.29e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019608
SMART Domains Protein: ENSMUSP00000019608
Gene: ENSMUSG00000019464

DomainStartEndE-ValueType
Pfam:7tm_1 52 354 2.3e-17 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 392 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128523
Predicted Effect probably benign
Transcript: ENSMUST00000132945
SMART Domains Protein: ENSMUSP00000115054
Gene: ENSMUSG00000057672

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Hr1 49 113 6.74e-20 SMART
Hr1 138 206 1.13e-21 SMART
Hr1 228 296 7.79e-25 SMART
C2 340 476 2.45e-1 SMART
low complexity region 581 613 N/A INTRINSIC
Pfam:Pkinase 631 756 2.2e-23 PFAM
Pfam:Pkinase_Tyr 631 757 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138898
Predicted Effect probably benign
Transcript: ENSMUST00000144258
AA Change: V910I

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116235
Gene: ENSMUSG00000057672
AA Change: V910I

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Hr1 42 106 6.74e-20 SMART
Hr1 131 199 1.13e-21 SMART
Hr1 221 289 7.79e-25 SMART
C2 333 469 2.45e-1 SMART
low complexity region 574 606 N/A INTRINSIC
S_TKc 624 883 2.83e-96 SMART
S_TK_X 884 948 5.29e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212519
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spontaneously formed GCs and developed an autoimmune-like disease with autoantibody production and glomerulonephritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Pkn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Pkn1 APN 8 83681006 missense probably damaging 0.96
IGL02058:Pkn1 APN 8 83681225 nonsense probably null
IGL03142:Pkn1 APN 8 83671023 missense possibly damaging 0.85
Xinjiang UTSW 8 83692927 nonsense probably null
R0115:Pkn1 UTSW 8 83671029 missense probably damaging 0.99
R0157:Pkn1 UTSW 8 83692820 missense probably damaging 1.00
R0304:Pkn1 UTSW 8 83683607 splice site probably benign
R0450:Pkn1 UTSW 8 83672324 missense probably damaging 1.00
R0469:Pkn1 UTSW 8 83672324 missense probably damaging 1.00
R1419:Pkn1 UTSW 8 83673522 missense probably damaging 0.99
R1539:Pkn1 UTSW 8 83670337 missense possibly damaging 0.49
R2025:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2026:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2027:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2029:Pkn1 UTSW 8 83677963 missense possibly damaging 0.92
R2886:Pkn1 UTSW 8 83681238 missense probably benign 0.28
R3017:Pkn1 UTSW 8 83670170 missense probably benign 0.13
R3402:Pkn1 UTSW 8 83670230 missense probably damaging 1.00
R4110:Pkn1 UTSW 8 83691199 missense probably benign 0.41
R4504:Pkn1 UTSW 8 83692927 nonsense probably null
R4739:Pkn1 UTSW 8 83671749 missense probably damaging 0.98
R4838:Pkn1 UTSW 8 83677966 missense probably damaging 1.00
R4857:Pkn1 UTSW 8 83684227 splice site probably null
R5239:Pkn1 UTSW 8 83684182 missense probably damaging 1.00
R5558:Pkn1 UTSW 8 83684722 missense probably damaging 1.00
R5613:Pkn1 UTSW 8 83677761 missense probably benign 0.00
R6169:Pkn1 UTSW 8 83681206 nonsense probably null
R6172:Pkn1 UTSW 8 83670755 missense possibly damaging 0.48
R6273:Pkn1 UTSW 8 83672270 missense probably damaging 0.96
R6318:Pkn1 UTSW 8 83683591 missense probably damaging 1.00
R6969:Pkn1 UTSW 8 83683426 missense probably damaging 1.00
R7142:Pkn1 UTSW 8 83693967 missense possibly damaging 0.50
R7157:Pkn1 UTSW 8 83671734 missense probably damaging 1.00
R7189:Pkn1 UTSW 8 83692673 missense possibly damaging 0.74
R7981:Pkn1 UTSW 8 83681008 missense probably damaging 0.99
R8876:Pkn1 UTSW 8 83672250 missense possibly damaging 0.94
R8953:Pkn1 UTSW 8 83684186 missense probably damaging 1.00
R9374:Pkn1 UTSW 8 83677738 missense probably benign 0.00
Z1176:Pkn1 UTSW 8 83673497 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCCAGATGCACACAGAGG -3'
(R):5'- TAGATTTATCTGAGTTCCCAGTCCC -3'

Sequencing Primer
(F):5'- TGCATGTATGGAGTAAACCCC -3'
(R):5'- GAGTTCCCAGTCCCTCCCC -3'
Posted On 2018-06-06