Mutagenetix > Incidental Mutation

Incidental Mutation 'R6531:Pkn1'

522355

Institutional Source

Beutler Lab

Gene Symbol

Pkn1

Ensembl Gene

ENSMUSG00000057672

Gene Name

protein kinase N1

Synonyms

PRK1, F730027O18Rik, PAK1, Prkcl1, Pkn, Stk3

MMRRC Submission

044657-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6531 (G1)

Quality Score

181.009

Status

Validated

Chromosome

Chromosomal Location

83666536-83699179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83670293 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 910 (V910I)

Ref Sequence

ENSEMBL: ENSMUSP00000116235 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005616] [ENSMUST00000019608] [ENSMUST00000132945] [ENSMUST00000144258]

AlphaFold

P70268

Predicted Effect

probably benign
Transcript: ENSMUST00000005616
AA Change: V905I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000005616
Gene: ENSMUSG00000057672
AA Change: V905I

Domain	Start	End	E-Value	Type
low complexity region	15	30	N/A	INTRINSIC
Hr1	37	101	6.74e-20	SMART
Hr1	126	194	1.13e-21	SMART
Hr1	216	284	7.79e-25	SMART
C2	328	464	2.45e-1	SMART
low complexity region	569	601	N/A	INTRINSIC
S_TKc	619	878	2.83e-96	SMART
S_TK_X	879	943	5.29e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000019608

SMART Domains

Protein: ENSMUSP00000019608
Gene: ENSMUSG00000019464

Domain	Start	End	E-Value	Type
Pfam:7tm_1	52	354	2.3e-17	PFAM
low complexity region	356	372	N/A	INTRINSIC
low complexity region	392	405	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124946

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128523

Predicted Effect

probably benign
Transcript: ENSMUST00000132945

SMART Domains

Protein: ENSMUSP00000115054
Gene: ENSMUSG00000057672

Domain	Start	End	E-Value	Type
low complexity region	27	42	N/A	INTRINSIC
Hr1	49	113	6.74e-20	SMART
Hr1	138	206	1.13e-21	SMART
Hr1	228	296	7.79e-25	SMART
C2	340	476	2.45e-1	SMART
low complexity region	581	613	N/A	INTRINSIC
Pfam:Pkinase	631	756	2.2e-23	PFAM
Pfam:Pkinase_Tyr	631	757	1.5e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138898

Predicted Effect

probably benign
Transcript: ENSMUST00000144258
AA Change: V910I

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000116235
Gene: ENSMUSG00000057672
AA Change: V910I

Domain	Start	End	E-Value	Type
low complexity region	20	35	N/A	INTRINSIC
Hr1	42	106	6.74e-20	SMART
Hr1	131	199	1.13e-21	SMART
Hr1	221	289	7.79e-25	SMART
C2	333	469	2.45e-1	SMART
low complexity region	574	606	N/A	INTRINSIC
S_TKc	624	883	2.83e-96	SMART
S_TK_X	884	948	5.29e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159935

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212519

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.2%
20x: 90.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spontaneously formed GCs and developed an autoimmune-like disease with autoantibody production and glomerulonephritis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,949,999	E880G	possibly damaging	Het
Acsbg2	T	A	17: 56,846,617	I529F	probably damaging	Het
Ahcyl2	T	G	6: 29,886,162	M359R	probably benign	Het
Aldh5a1	G	T	13: 24,918,564	D305E	probably benign	Het
Catsper2	C	G	2: 121,399,780	V358L	possibly damaging	Het
Cd200r4	C	T	16: 44,833,505	Q222*	probably null	Het
Col4a2	T	A	8: 11,408,135	D270E	probably benign	Het
Cux1	T	C	5: 136,275,119	D1401G	probably benign	Het
Cyp3a59	T	A	5: 146,098,217	M235K	probably benign	Het
Dock3	T	C	9: 106,967,216	D895G	probably benign	Het
Dusp27	A	T	1: 166,110,046		probably null	Het
Dync1h1	T	C	12: 110,617,920	F586L	probably damaging	Het
Elmo1	G	T	13: 20,572,446	R568L	possibly damaging	Het
Epb41	T	C	4: 131,957,636	T711A	probably benign	Het
Grm7	T	A	6: 111,358,425	M599K	probably benign	Het
Hivep3	A	T	4: 120,122,876	K1704*	probably null	Het
Ighv1-62-3	C	A	12: 115,461,006	C115F	probably damaging	Het
Krt78	A	G	15: 101,952,273	Y200H	probably benign	Het
Lamb2	A	T	9: 108,483,726	H549L	possibly damaging	Het
Mroh3	A	G	1: 136,184,353	I759T	probably benign	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Nol6	G	T	4: 41,118,154	P828T	probably benign	Het
Olfr1030	A	G	2: 85,984,307	I156V	probably benign	Het
Olfr1132	A	G	2: 87,635,529	Y73H	probably damaging	Het
Olfr1264	A	G	2: 90,021,457	V203A	probably benign	Het
Olfr344	G	A	2: 36,569,341	V248I	probably damaging	Het
Ovgp1	A	C	3: 105,987,071		probably benign	Het
Pitpnm3	T	A	11: 72,071,487	Q230L	possibly damaging	Het
Plcb1	T	A	2: 135,325,802		probably null	Het
Ppp1r12c	A	G	7: 4,482,789		probably null	Het
Rassf5	T	A	1: 131,244,814	Q106L	possibly damaging	Het
Rfc1	T	C	5: 65,312,979	K62E	possibly damaging	Het
Sf3b1	C	T	1: 55,019,395	E12K	probably damaging	Het
Slc4a1ap	A	T	5: 31,548,638	D691V	probably benign	Het
Speg	T	A	1: 75,422,757	F2283I	probably benign	Het
Synj2	A	G	17: 6,033,839	K267E	probably damaging	Het
Tg	A	T	15: 66,839,362	Y991F	probably damaging	Het
Tlk1	A	T	2: 70,742,083	D380E	probably benign	Het
Trim43b	A	T	9: 89,085,365	L405H	probably damaging	Het
Ttf2	A	G	3: 100,956,260	I586T	probably damaging	Het
Ugt2b36	T	A	5: 87,081,586	R213S	probably damaging	Het
Vmn1r198	T	A	13: 22,354,407	M21K	probably benign	Het
Wdr35	A	T	12: 8,978,685	Y101F	probably benign	Het
Zfp367	T	C	13: 64,144,250	Y189C	probably damaging	Het

Other mutations in Pkn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Pkn1	APN	8	83681006	missense	probably damaging	0.96
IGL02058:Pkn1	APN	8	83681225	nonsense	probably null
IGL03142:Pkn1	APN	8	83671023	missense	possibly damaging	0.85
Xinjiang	UTSW	8	83692927	nonsense	probably null
R0115:Pkn1	UTSW	8	83671029	missense	probably damaging	0.99
R0157:Pkn1	UTSW	8	83692820	missense	probably damaging	1.00
R0304:Pkn1	UTSW	8	83683607	splice site	probably benign
R0450:Pkn1	UTSW	8	83672324	missense	probably damaging	1.00
R0469:Pkn1	UTSW	8	83672324	missense	probably damaging	1.00
R1419:Pkn1	UTSW	8	83673522	missense	probably damaging	0.99
R1539:Pkn1	UTSW	8	83670337	missense	possibly damaging	0.49
R2025:Pkn1	UTSW	8	83671378	missense	probably damaging	1.00
R2026:Pkn1	UTSW	8	83671378	missense	probably damaging	1.00
R2027:Pkn1	UTSW	8	83671378	missense	probably damaging	1.00
R2029:Pkn1	UTSW	8	83677963	missense	possibly damaging	0.92
R2886:Pkn1	UTSW	8	83681238	missense	probably benign	0.28
R3017:Pkn1	UTSW	8	83670170	missense	probably benign	0.13
R3402:Pkn1	UTSW	8	83670230	missense	probably damaging	1.00
R4110:Pkn1	UTSW	8	83691199	missense	probably benign	0.41
R4504:Pkn1	UTSW	8	83692927	nonsense	probably null
R4739:Pkn1	UTSW	8	83671749	missense	probably damaging	0.98
R4838:Pkn1	UTSW	8	83677966	missense	probably damaging	1.00
R4857:Pkn1	UTSW	8	83684227	splice site	probably null
R5239:Pkn1	UTSW	8	83684182	missense	probably damaging	1.00
R5558:Pkn1	UTSW	8	83684722	missense	probably damaging	1.00
R5613:Pkn1	UTSW	8	83677761	missense	probably benign	0.00
R6169:Pkn1	UTSW	8	83681206	nonsense	probably null
R6172:Pkn1	UTSW	8	83670755	missense	possibly damaging	0.48
R6273:Pkn1	UTSW	8	83672270	missense	probably damaging	0.96
R6318:Pkn1	UTSW	8	83683591	missense	probably damaging	1.00
R6969:Pkn1	UTSW	8	83683426	missense	probably damaging	1.00
R7142:Pkn1	UTSW	8	83693967	missense	possibly damaging	0.50
R7157:Pkn1	UTSW	8	83671734	missense	probably damaging	1.00
R7189:Pkn1	UTSW	8	83692673	missense	possibly damaging	0.74
R7981:Pkn1	UTSW	8	83681008	missense	probably damaging	0.99
R8876:Pkn1	UTSW	8	83672250	missense	possibly damaging	0.94
R8953:Pkn1	UTSW	8	83684186	missense	probably damaging	1.00
R9048:Pkn1	UTSW	8	83698034	missense	possibly damaging	0.91
R9374:Pkn1	UTSW	8	83677738	missense	probably benign	0.00
R9495:Pkn1	UTSW	8	83684170	missense	possibly damaging	0.95
R9549:Pkn1	UTSW	8	83692845	missense	probably damaging	1.00
Z1176:Pkn1	UTSW	8	83673497	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTCCAGATGCACACAGAGG -3'
(R):5'- TAGATTTATCTGAGTTCCCAGTCCC -3'

Sequencing Primer
(F):5'- TGCATGTATGGAGTAAACCCC -3'
(R):5'- GAGTTCCCAGTCCCTCCCC -3'

Posted On

2018-06-06