Mutagenetix > Incidental Mutation

Incidental Mutation 'R6531:Pitpnm3'

522363

Institutional Source

Beutler Lab

Gene Symbol

Pitpnm3

Ensembl Gene

ENSMUSG00000040543

Gene Name

PITPNM family member 3

Synonyms

Ackr6, A330068P14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R6531 (G1)

Quality Score

211.009

Status

Validated

Chromosome

Chromosomal Location

72047528-72135778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 72071487 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 230 (Q230L)

Ref Sequence

ENSEMBL: ENSMUSP00000074737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075258] [ENSMUST00000108508]

AlphaFold

Q3UHE1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075258
AA Change: Q230L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000074737
Gene: ENSMUSG00000040543
AA Change: Q230L

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
low complexity region	25	37	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
Blast:DDHD	141	361	1e-105	BLAST
DDHD	390	594	1.49e-91	SMART
LNS2	739	870	2.12e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108508
AA Change: Q214L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000104148
Gene: ENSMUSG00000040543
AA Change: Q214L

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
low complexity region	25	37	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
Blast:DDHD	125	345	1e-106	BLAST
DDHD	374	578	1.49e-91	SMART
LNS2	723	854	2.12e-55	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142471

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.2%
20x: 90.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,949,999	E880G	possibly damaging	Het
Acsbg2	T	A	17: 56,846,617	I529F	probably damaging	Het
Ahcyl2	T	G	6: 29,886,162	M359R	probably benign	Het
Aldh5a1	G	T	13: 24,918,564	D305E	probably benign	Het
Catsper2	C	G	2: 121,399,780	V358L	possibly damaging	Het
Cd200r4	C	T	16: 44,833,505	Q222*	probably null	Het
Col4a2	T	A	8: 11,408,135	D270E	probably benign	Het
Cux1	T	C	5: 136,275,119	D1401G	probably benign	Het
Cyp3a59	T	A	5: 146,098,217	M235K	probably benign	Het
Dock3	T	C	9: 106,967,216	D895G	probably benign	Het
Dusp27	A	T	1: 166,110,046		probably null	Het
Dync1h1	T	C	12: 110,617,920	F586L	probably damaging	Het
Elmo1	G	T	13: 20,572,446	R568L	possibly damaging	Het
Epb41	T	C	4: 131,957,636	T711A	probably benign	Het
Grm7	T	A	6: 111,358,425	M599K	probably benign	Het
Hivep3	A	T	4: 120,122,876	K1704*	probably null	Het
Ighv1-62-3	C	A	12: 115,461,006	C115F	probably damaging	Het
Krt78	A	G	15: 101,952,273	Y200H	probably benign	Het
Lamb2	A	T	9: 108,483,726	H549L	possibly damaging	Het
Mroh3	A	G	1: 136,184,353	I759T	probably benign	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Nol6	G	T	4: 41,118,154	P828T	probably benign	Het
Olfr1030	A	G	2: 85,984,307	I156V	probably benign	Het
Olfr1132	A	G	2: 87,635,529	Y73H	probably damaging	Het
Olfr1264	A	G	2: 90,021,457	V203A	probably benign	Het
Olfr344	G	A	2: 36,569,341	V248I	probably damaging	Het
Ovgp1	A	C	3: 105,987,071		probably benign	Het
Pkn1	C	T	8: 83,670,293	V910I	probably benign	Het
Plcb1	T	A	2: 135,325,802		probably null	Het
Ppp1r12c	A	G	7: 4,482,789		probably null	Het
Rassf5	T	A	1: 131,244,814	Q106L	possibly damaging	Het
Rfc1	T	C	5: 65,312,979	K62E	possibly damaging	Het
Sf3b1	C	T	1: 55,019,395	E12K	probably damaging	Het
Slc4a1ap	A	T	5: 31,548,638	D691V	probably benign	Het
Speg	T	A	1: 75,422,757	F2283I	probably benign	Het
Synj2	A	G	17: 6,033,839	K267E	probably damaging	Het
Tg	A	T	15: 66,839,362	Y991F	probably damaging	Het
Tlk1	A	T	2: 70,742,083	D380E	probably benign	Het
Trim43b	A	T	9: 89,085,365	L405H	probably damaging	Het
Ttf2	A	G	3: 100,956,260	I586T	probably damaging	Het
Ugt2b36	T	A	5: 87,081,586	R213S	probably damaging	Het
Vmn1r198	T	A	13: 22,354,407	M21K	probably benign	Het
Wdr35	A	T	12: 8,978,685	Y101F	probably benign	Het
Zfp367	T	C	13: 64,144,250	Y189C	probably damaging	Het

Other mutations in Pitpnm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01818:Pitpnm3	APN	11	72112251	splice site	probably benign
IGL01871:Pitpnm3	APN	11	72056138	missense	probably damaging	0.99
IGL02058:Pitpnm3	APN	11	72120139	missense	probably benign	0.31
IGL02267:Pitpnm3	APN	11	72071448	missense	probably benign	0.02
IGL02370:Pitpnm3	APN	11	72051858	missense	probably benign	0.04
IGL02613:Pitpnm3	APN	11	72058072	missense	probably damaging	1.00
IGL02835:Pitpnm3	APN	11	72061466	splice site	probably benign
IGL02946:Pitpnm3	APN	11	72092552	missense	probably benign	0.08
IGL02989:Pitpnm3	APN	11	72120186	splice site	probably benign
IGL03173:Pitpnm3	APN	11	72092563	missense	probably benign	0.02
IGL03357:Pitpnm3	APN	11	72070890	nonsense	probably null
Frank	UTSW	11	72070396	missense	probably benign
Mickey	UTSW	11	72070964	missense	probably damaging	1.00
Stuart	UTSW	11	72051929	missense	probably null	0.99
R0102:Pitpnm3	UTSW	11	72056246	missense	probably damaging	1.00
R0193:Pitpnm3	UTSW	11	72070492	splice site	probably benign
R0964:Pitpnm3	UTSW	11	72058470	missense	probably damaging	1.00
R1475:Pitpnm3	UTSW	11	72074627	missense	probably damaging	1.00
R1566:Pitpnm3	UTSW	11	72058959	splice site	probably null
R1951:Pitpnm3	UTSW	11	72074624	missense	possibly damaging	0.88
R3915:Pitpnm3	UTSW	11	72112284	missense	probably damaging	1.00
R4192:Pitpnm3	UTSW	11	72051959	missense	possibly damaging	0.96
R4278:Pitpnm3	UTSW	11	72074516	missense	probably damaging	1.00
R4928:Pitpnm3	UTSW	11	72063172	missense	probably damaging	1.00
R5543:Pitpnm3	UTSW	11	72056197	missense	probably damaging	0.99
R5626:Pitpnm3	UTSW	11	72112332	missense	probably benign	0.04
R5635:Pitpnm3	UTSW	11	72067160	missense	possibly damaging	0.95
R5958:Pitpnm3	UTSW	11	72112367	splice site	probably null
R6634:Pitpnm3	UTSW	11	72051929	missense	probably null	0.99
R6764:Pitpnm3	UTSW	11	72051233	missense	probably damaging	1.00
R6912:Pitpnm3	UTSW	11	72070396	missense	probably benign
R7132:Pitpnm3	UTSW	11	72051276	missense	possibly damaging	0.86
R7307:Pitpnm3	UTSW	11	72070964	missense	probably damaging	1.00
R7561:Pitpnm3	UTSW	11	72051182	missense	probably benign	0.02
R7771:Pitpnm3	UTSW	11	72061488	nonsense	probably null
R8099:Pitpnm3	UTSW	11	72070318	missense	possibly damaging	0.85
R8753:Pitpnm3	UTSW	11	72051878	missense	probably benign	0.01
R8817:Pitpnm3	UTSW	11	72051068	missense	possibly damaging	0.74
R8987:Pitpnm3	UTSW	11	72112306	missense	probably damaging	1.00
R9054:Pitpnm3	UTSW	11	72056191	missense	probably damaging	0.97
R9450:Pitpnm3	UTSW	11	72061586	missense	possibly damaging	0.50
R9508:Pitpnm3	UTSW	11	72112295	missense	probably damaging	1.00
R9606:Pitpnm3	UTSW	11	72064243	missense	probably benign	0.02
R9740:Pitpnm3	UTSW	11	72056276	missense	probably benign	0.34
X0018:Pitpnm3	UTSW	11	72071440	missense	probably benign	0.42
X0062:Pitpnm3	UTSW	11	72067108	missense	probably damaging	1.00
Z1186:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1186:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1187:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1187:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1188:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1188:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1189:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1189:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1190:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1190:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1191:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1191:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1192:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1192:Pitpnm3	UTSW	11	72120143	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCTTAACCCTTGCAGCAG -3'
(R):5'- CCATGTGATTTGCCTCAGTG -3'

Sequencing Primer
(F):5'- AGATCCCACCCCCTTTTAGGTAG -3'
(R):5'- ACATTTTTCTGGAGCTGAGCATG -3'

Posted On

2018-06-06