Incidental Mutation 'R6531:Pitpnm3'
ID 522363
Institutional Source Beutler Lab
Gene Symbol Pitpnm3
Ensembl Gene ENSMUSG00000040543
Gene Name PITPNM family member 3
Synonyms A330068P14Rik, Ackr6
MMRRC Submission 044657-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R6531 (G1)
Quality Score 211.009
Status Validated
Chromosome 11
Chromosomal Location 71938354-72026604 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71962313 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 230 (Q230L)
Ref Sequence ENSEMBL: ENSMUSP00000074737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075258] [ENSMUST00000108508]
AlphaFold Q3UHE1
Predicted Effect possibly damaging
Transcript: ENSMUST00000075258
AA Change: Q230L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074737
Gene: ENSMUSG00000040543
AA Change: Q230L

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Blast:DDHD 141 361 1e-105 BLAST
DDHD 390 594 1.49e-91 SMART
LNS2 739 870 2.12e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108508
AA Change: Q214L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104148
Gene: ENSMUSG00000040543
AA Change: Q214L

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
Blast:DDHD 125 345 1e-106 BLAST
DDHD 374 578 1.49e-91 SMART
LNS2 723 854 2.12e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142471
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,926,980 (GRCm39) E880G possibly damaging Het
Acsbg2 T A 17: 57,153,617 (GRCm39) I529F probably damaging Het
Ahcyl2 T G 6: 29,886,161 (GRCm39) M359R probably benign Het
Aldh5a1 G T 13: 25,102,547 (GRCm39) D305E probably benign Het
Catsper2 C G 2: 121,230,261 (GRCm39) V358L possibly damaging Het
Cd200r4 C T 16: 44,653,868 (GRCm39) Q222* probably null Het
Col4a2 T A 8: 11,458,135 (GRCm39) D270E probably benign Het
Cux1 T C 5: 136,303,973 (GRCm39) D1401G probably benign Het
Cyp3a59 T A 5: 146,035,027 (GRCm39) M235K probably benign Het
Dock3 T C 9: 106,844,415 (GRCm39) D895G probably benign Het
Dync1h1 T C 12: 110,584,354 (GRCm39) F586L probably damaging Het
Elmo1 G T 13: 20,756,616 (GRCm39) R568L possibly damaging Het
Epb41 T C 4: 131,684,947 (GRCm39) T711A probably benign Het
Grm7 T A 6: 111,335,386 (GRCm39) M599K probably benign Het
Hivep3 A T 4: 119,980,073 (GRCm39) K1704* probably null Het
Ighv1-62-3 C A 12: 115,424,626 (GRCm39) C115F probably damaging Het
Krt78 A G 15: 101,860,708 (GRCm39) Y200H probably benign Het
Lamb2 A T 9: 108,360,925 (GRCm39) H549L possibly damaging Het
Mroh3 A G 1: 136,112,091 (GRCm39) I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,775,161 (GRCm39) probably null Het
Nol6 G T 4: 41,118,154 (GRCm39) P828T probably benign Het
Or1j15 G A 2: 36,459,353 (GRCm39) V248I probably damaging Het
Or4c3 A G 2: 89,851,801 (GRCm39) V203A probably benign Het
Or5m5 A G 2: 85,814,651 (GRCm39) I156V probably benign Het
Or8w1 A G 2: 87,465,873 (GRCm39) Y73H probably damaging Het
Ovgp1 A C 3: 105,894,387 (GRCm39) probably benign Het
Pkn1 C T 8: 84,396,922 (GRCm39) V910I probably benign Het
Plcb1 T A 2: 135,167,722 (GRCm39) probably null Het
Ppp1r12c A G 7: 4,485,788 (GRCm39) probably null Het
Rassf5 T A 1: 131,172,551 (GRCm39) Q106L possibly damaging Het
Rfc1 T C 5: 65,470,322 (GRCm39) K62E possibly damaging Het
Sf3b1 C T 1: 55,058,554 (GRCm39) E12K probably damaging Het
Slc4a1ap A T 5: 31,705,982 (GRCm39) D691V probably benign Het
Speg T A 1: 75,399,401 (GRCm39) F2283I probably benign Het
Styxl2 A T 1: 165,937,615 (GRCm39) probably null Het
Synj2 A G 17: 6,084,114 (GRCm39) K267E probably damaging Het
Tg A T 15: 66,711,211 (GRCm39) Y991F probably damaging Het
Tlk1 A T 2: 70,572,427 (GRCm39) D380E probably benign Het
Trim43b A T 9: 88,967,418 (GRCm39) L405H probably damaging Het
Ttf2 A G 3: 100,863,576 (GRCm39) I586T probably damaging Het
Ugt2b36 T A 5: 87,229,445 (GRCm39) R213S probably damaging Het
Vmn1r198 T A 13: 22,538,577 (GRCm39) M21K probably benign Het
Wdr35 A T 12: 9,028,685 (GRCm39) Y101F probably benign Het
Zfp367 T C 13: 64,292,064 (GRCm39) Y189C probably damaging Het
Other mutations in Pitpnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Pitpnm3 APN 11 72,003,077 (GRCm39) splice site probably benign
IGL01871:Pitpnm3 APN 11 71,946,964 (GRCm39) missense probably damaging 0.99
IGL02058:Pitpnm3 APN 11 72,010,965 (GRCm39) missense probably benign 0.31
IGL02267:Pitpnm3 APN 11 71,962,274 (GRCm39) missense probably benign 0.02
IGL02370:Pitpnm3 APN 11 71,942,684 (GRCm39) missense probably benign 0.04
IGL02613:Pitpnm3 APN 11 71,948,898 (GRCm39) missense probably damaging 1.00
IGL02835:Pitpnm3 APN 11 71,952,292 (GRCm39) splice site probably benign
IGL02946:Pitpnm3 APN 11 71,983,378 (GRCm39) missense probably benign 0.08
IGL02989:Pitpnm3 APN 11 72,011,012 (GRCm39) splice site probably benign
IGL03173:Pitpnm3 APN 11 71,983,389 (GRCm39) missense probably benign 0.02
IGL03357:Pitpnm3 APN 11 71,961,716 (GRCm39) nonsense probably null
Frank UTSW 11 71,961,222 (GRCm39) missense probably benign
Mickey UTSW 11 71,961,790 (GRCm39) missense probably damaging 1.00
Stuart UTSW 11 71,942,755 (GRCm39) missense probably null 0.99
R0102:Pitpnm3 UTSW 11 71,947,072 (GRCm39) missense probably damaging 1.00
R0193:Pitpnm3 UTSW 11 71,961,318 (GRCm39) splice site probably benign
R0964:Pitpnm3 UTSW 11 71,949,296 (GRCm39) missense probably damaging 1.00
R1475:Pitpnm3 UTSW 11 71,965,453 (GRCm39) missense probably damaging 1.00
R1566:Pitpnm3 UTSW 11 71,949,785 (GRCm39) splice site probably null
R1951:Pitpnm3 UTSW 11 71,965,450 (GRCm39) missense possibly damaging 0.88
R3915:Pitpnm3 UTSW 11 72,003,110 (GRCm39) missense probably damaging 1.00
R4192:Pitpnm3 UTSW 11 71,942,785 (GRCm39) missense possibly damaging 0.96
R4278:Pitpnm3 UTSW 11 71,965,342 (GRCm39) missense probably damaging 1.00
R4928:Pitpnm3 UTSW 11 71,953,998 (GRCm39) missense probably damaging 1.00
R5543:Pitpnm3 UTSW 11 71,947,023 (GRCm39) missense probably damaging 0.99
R5626:Pitpnm3 UTSW 11 72,003,158 (GRCm39) missense probably benign 0.04
R5635:Pitpnm3 UTSW 11 71,957,986 (GRCm39) missense possibly damaging 0.95
R5958:Pitpnm3 UTSW 11 72,003,193 (GRCm39) splice site probably null
R6634:Pitpnm3 UTSW 11 71,942,755 (GRCm39) missense probably null 0.99
R6764:Pitpnm3 UTSW 11 71,942,059 (GRCm39) missense probably damaging 1.00
R6912:Pitpnm3 UTSW 11 71,961,222 (GRCm39) missense probably benign
R7132:Pitpnm3 UTSW 11 71,942,102 (GRCm39) missense possibly damaging 0.86
R7307:Pitpnm3 UTSW 11 71,961,790 (GRCm39) missense probably damaging 1.00
R7561:Pitpnm3 UTSW 11 71,942,008 (GRCm39) missense probably benign 0.02
R7771:Pitpnm3 UTSW 11 71,952,314 (GRCm39) nonsense probably null
R8099:Pitpnm3 UTSW 11 71,961,144 (GRCm39) missense possibly damaging 0.85
R8753:Pitpnm3 UTSW 11 71,942,704 (GRCm39) missense probably benign 0.01
R8817:Pitpnm3 UTSW 11 71,941,894 (GRCm39) missense possibly damaging 0.74
R8987:Pitpnm3 UTSW 11 72,003,132 (GRCm39) missense probably damaging 1.00
R9054:Pitpnm3 UTSW 11 71,947,017 (GRCm39) missense probably damaging 0.97
R9450:Pitpnm3 UTSW 11 71,952,412 (GRCm39) missense possibly damaging 0.50
R9508:Pitpnm3 UTSW 11 72,003,121 (GRCm39) missense probably damaging 1.00
R9606:Pitpnm3 UTSW 11 71,955,069 (GRCm39) missense probably benign 0.02
R9740:Pitpnm3 UTSW 11 71,947,102 (GRCm39) missense probably benign 0.34
X0018:Pitpnm3 UTSW 11 71,962,266 (GRCm39) missense probably benign 0.42
X0062:Pitpnm3 UTSW 11 71,957,934 (GRCm39) missense probably damaging 1.00
Z1186:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1186:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1187:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1187:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1188:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1188:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1189:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1189:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1190:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1190:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1191:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1191:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1192:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1192:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTTAACCCTTGCAGCAG -3'
(R):5'- CCATGTGATTTGCCTCAGTG -3'

Sequencing Primer
(F):5'- AGATCCCACCCCCTTTTAGGTAG -3'
(R):5'- ACATTTTTCTGGAGCTGAGCATG -3'
Posted On 2018-06-06