Incidental Mutation 'R6531:Pitpnm3'
ID522363
Institutional Source Beutler Lab
Gene Symbol Pitpnm3
Ensembl Gene ENSMUSG00000040543
Gene NamePITPNM family member 3
SynonymsAckr6, A330068P14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6531 (G1)
Quality Score211.009
Status Validated
Chromosome11
Chromosomal Location72047528-72135778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72071487 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 230 (Q230L)
Ref Sequence ENSEMBL: ENSMUSP00000074737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075258] [ENSMUST00000108508]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075258
AA Change: Q230L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074737
Gene: ENSMUSG00000040543
AA Change: Q230L

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Blast:DDHD 141 361 1e-105 BLAST
DDHD 390 594 1.49e-91 SMART
LNS2 739 870 2.12e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108508
AA Change: Q214L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104148
Gene: ENSMUSG00000040543
AA Change: Q214L

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
Blast:DDHD 125 345 1e-106 BLAST
DDHD 374 578 1.49e-91 SMART
LNS2 723 854 2.12e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142471
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Pitpnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Pitpnm3 APN 11 72112251 splice site probably benign
IGL01871:Pitpnm3 APN 11 72056138 missense probably damaging 0.99
IGL02058:Pitpnm3 APN 11 72120139 missense probably benign 0.31
IGL02267:Pitpnm3 APN 11 72071448 missense probably benign 0.02
IGL02370:Pitpnm3 APN 11 72051858 missense probably benign 0.04
IGL02613:Pitpnm3 APN 11 72058072 missense probably damaging 1.00
IGL02835:Pitpnm3 APN 11 72061466 splice site probably benign
IGL02946:Pitpnm3 APN 11 72092552 missense probably benign 0.08
IGL02989:Pitpnm3 APN 11 72120186 splice site probably benign
IGL03173:Pitpnm3 APN 11 72092563 missense probably benign 0.02
IGL03357:Pitpnm3 APN 11 72070890 nonsense probably null
Frank UTSW 11 72070396 missense probably benign
Mickey UTSW 11 72070964 missense probably damaging 1.00
Stuart UTSW 11 72051929 missense probably null 0.99
R0102:Pitpnm3 UTSW 11 72056246 missense probably damaging 1.00
R0193:Pitpnm3 UTSW 11 72070492 splice site probably benign
R0964:Pitpnm3 UTSW 11 72058470 missense probably damaging 1.00
R1475:Pitpnm3 UTSW 11 72074627 missense probably damaging 1.00
R1566:Pitpnm3 UTSW 11 72058959 splice site probably null
R1951:Pitpnm3 UTSW 11 72074624 missense possibly damaging 0.88
R3915:Pitpnm3 UTSW 11 72112284 missense probably damaging 1.00
R4192:Pitpnm3 UTSW 11 72051959 missense possibly damaging 0.96
R4278:Pitpnm3 UTSW 11 72074516 missense probably damaging 1.00
R4928:Pitpnm3 UTSW 11 72063172 missense probably damaging 1.00
R5543:Pitpnm3 UTSW 11 72056197 missense probably damaging 0.99
R5626:Pitpnm3 UTSW 11 72112332 missense probably benign 0.04
R5635:Pitpnm3 UTSW 11 72067160 missense possibly damaging 0.95
R5958:Pitpnm3 UTSW 11 72112367 splice site probably null
R6634:Pitpnm3 UTSW 11 72051929 missense probably null 0.99
R6764:Pitpnm3 UTSW 11 72051233 missense probably damaging 1.00
R6912:Pitpnm3 UTSW 11 72070396 missense probably benign
R7132:Pitpnm3 UTSW 11 72051276 missense possibly damaging 0.86
R7307:Pitpnm3 UTSW 11 72070964 missense probably damaging 1.00
R7561:Pitpnm3 UTSW 11 72051182 missense probably benign 0.02
R7771:Pitpnm3 UTSW 11 72061488 nonsense probably null
X0018:Pitpnm3 UTSW 11 72071440 missense probably benign 0.42
X0062:Pitpnm3 UTSW 11 72067108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTAACCCTTGCAGCAG -3'
(R):5'- CCATGTGATTTGCCTCAGTG -3'

Sequencing Primer
(F):5'- AGATCCCACCCCCTTTTAGGTAG -3'
(R):5'- ACATTTTTCTGGAGCTGAGCATG -3'
Posted On2018-06-06