Incidental Mutation 'R6531:Ighv1-62-3'
ID522368
Institutional Source Beutler Lab
Gene Symbol Ighv1-62-3
Ensembl Gene ENSMUSG00000096767
Gene Nameimmunoglobulin heavy variable 1-62-3
SynonymsGm9235
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R6531 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location115460999-115461431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115461006 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 115 (C115F)
Ref Sequence ENSEMBL: ENSMUSP00000100313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103532]
Predicted Effect probably damaging
Transcript: ENSMUST00000103532
AA Change: C115F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100313
Gene: ENSMUSG00000096767
AA Change: C115F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGv 36 117 2.84e-26 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Ighv1-62-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Ighv1-62-3 APN 12 115460993 unclassified probably benign
R4788:Ighv1-62-3 UTSW 12 115461052 missense probably benign 0.01
R5039:Ighv1-62-3 UTSW 12 115461394 missense probably benign 0.17
R5231:Ighv1-62-3 UTSW 12 115461051 missense possibly damaging 0.90
R6151:Ighv1-62-3 UTSW 12 115461289 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCAAAGTGGACAAAAGCACTAC -3'
(R):5'- TCTGGCTACACCTTCACCAG -3'

Sequencing Primer
(F):5'- GTGGACAAAAGCACTACAGGACTC -3'
(R):5'- AGCTACTGGATGCACTGGG -3'
Posted On2018-06-06