Mutagenetix > Incidental Mutation

Incidental Mutation 'R6531:Elmo1'

522370

Institutional Source

Beutler Lab

Gene Symbol

Elmo1

Ensembl Gene

ENSMUSG00000041112

Gene Name

engulfment and cell motility 1

Synonyms

C230095H21Rik, 6330578D22Rik, CED-12

MMRRC Submission

044657-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6531 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20090596-20608353 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 20572446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 568 (R568L)

Ref Sequence

ENSEMBL: ENSMUSP00000072334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072519]

AlphaFold

Q8BPU7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072519
AA Change: R568L

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000072334
Gene: ENSMUSG00000041112
AA Change: R568L

Domain	Start	End	E-Value	Type
Pfam:DUF3361	115	280	3.8e-64	PFAM
Pfam:ELMO_CED12	303	481	2.8e-42	PFAM
PH	555	676	2.32e0	SMART
low complexity region	704	717	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180767

Meta Mutation Damage Score

0.2344

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.2%
20x: 90.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired Sertoli cell phagocytosis of apoptotic male germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,949,999	E880G	possibly damaging	Het
Acsbg2	T	A	17: 56,846,617	I529F	probably damaging	Het
Ahcyl2	T	G	6: 29,886,162	M359R	probably benign	Het
Aldh5a1	G	T	13: 24,918,564	D305E	probably benign	Het
Catsper2	C	G	2: 121,399,780	V358L	possibly damaging	Het
Cd200r4	C	T	16: 44,833,505	Q222*	probably null	Het
Col4a2	T	A	8: 11,408,135	D270E	probably benign	Het
Cux1	T	C	5: 136,275,119	D1401G	probably benign	Het
Cyp3a59	T	A	5: 146,098,217	M235K	probably benign	Het
Dock3	T	C	9: 106,967,216	D895G	probably benign	Het
Dusp27	A	T	1: 166,110,046		probably null	Het
Dync1h1	T	C	12: 110,617,920	F586L	probably damaging	Het
Epb41	T	C	4: 131,957,636	T711A	probably benign	Het
Grm7	T	A	6: 111,358,425	M599K	probably benign	Het
Hivep3	A	T	4: 120,122,876	K1704*	probably null	Het
Ighv1-62-3	C	A	12: 115,461,006	C115F	probably damaging	Het
Krt78	A	G	15: 101,952,273	Y200H	probably benign	Het
Lamb2	A	T	9: 108,483,726	H549L	possibly damaging	Het
Mroh3	A	G	1: 136,184,353	I759T	probably benign	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Nol6	G	T	4: 41,118,154	P828T	probably benign	Het
Olfr1030	A	G	2: 85,984,307	I156V	probably benign	Het
Olfr1132	A	G	2: 87,635,529	Y73H	probably damaging	Het
Olfr1264	A	G	2: 90,021,457	V203A	probably benign	Het
Olfr344	G	A	2: 36,569,341	V248I	probably damaging	Het
Ovgp1	A	C	3: 105,987,071		probably benign	Het
Pitpnm3	T	A	11: 72,071,487	Q230L	possibly damaging	Het
Pkn1	C	T	8: 83,670,293	V910I	probably benign	Het
Plcb1	T	A	2: 135,325,802		probably null	Het
Ppp1r12c	A	G	7: 4,482,789		probably null	Het
Rassf5	T	A	1: 131,244,814	Q106L	possibly damaging	Het
Rfc1	T	C	5: 65,312,979	K62E	possibly damaging	Het
Sf3b1	C	T	1: 55,019,395	E12K	probably damaging	Het
Slc4a1ap	A	T	5: 31,548,638	D691V	probably benign	Het
Speg	T	A	1: 75,422,757	F2283I	probably benign	Het
Synj2	A	G	17: 6,033,839	K267E	probably damaging	Het
Tg	A	T	15: 66,839,362	Y991F	probably damaging	Het
Tlk1	A	T	2: 70,742,083	D380E	probably benign	Het
Trim43b	A	T	9: 89,085,365	L405H	probably damaging	Het
Ttf2	A	G	3: 100,956,260	I586T	probably damaging	Het
Ugt2b36	T	A	5: 87,081,586	R213S	probably damaging	Het
Vmn1r198	T	A	13: 22,354,407	M21K	probably benign	Het
Wdr35	A	T	12: 8,978,685	Y101F	probably benign	Het
Zfp367	T	C	13: 64,144,250	Y189C	probably damaging	Het

Other mutations in Elmo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00548:Elmo1	APN	13	20261579	missense	probably benign
IGL00814:Elmo1	APN	13	20286724	missense	probably damaging	0.97
IGL00849:Elmo1	APN	13	20582323	nonsense	probably null
IGL01417:Elmo1	APN	13	20251175	critical splice donor site	probably null
IGL01994:Elmo1	APN	13	20342464	missense	probably damaging	0.99
IGL02435:Elmo1	APN	13	20589656	missense	probably damaging	1.00
IGL02605:Elmo1	APN	13	20605202	missense	probably damaging	1.00
IGL02716:Elmo1	APN	13	20449502	missense	probably damaging	0.98
IGL03389:Elmo1	APN	13	20342426	missense	probably damaging	0.98
braveheart	UTSW	13	20274621	critical splice donor site	probably benign
Debil	UTSW	13	20373161	missense	probably damaging	1.00
Dollie	UTSW	13	20572446	missense	possibly damaging	0.91
Edinburg	UTSW	13	20290383	nonsense	probably null
glasgow	UTSW	13	20589642	critical splice acceptor site	probably null
Golly	UTSW	13	20373116	missense	possibly damaging	0.96
Lockerbie	UTSW	13	20600201	missense	probably damaging	1.00
sesame	UTSW	13	20600212	nonsense	probably null
Tickle	UTSW	13	20280803	splice site	probably null
Wilmut	UTSW	13	20582268	nonsense	probably null
Writhe	UTSW	13	20600259	critical splice donor site	probably null
H8562:Elmo1	UTSW	13	20280863	missense	probably damaging	1.00
R0360:Elmo1	UTSW	13	20564493	nonsense	probably null
R0364:Elmo1	UTSW	13	20564493	nonsense	probably null
R0372:Elmo1	UTSW	13	20572459	critical splice donor site	probably null
R0975:Elmo1	UTSW	13	20251137	missense	probably damaging	0.98
R1167:Elmo1	UTSW	13	20185455	missense	probably damaging	1.00
R1511:Elmo1	UTSW	13	20290477	missense	possibly damaging	0.60
R1671:Elmo1	UTSW	13	20287884	splice site	probably benign
R1677:Elmo1	UTSW	13	20589671	missense	probably benign	0.22
R1868:Elmo1	UTSW	13	20589653	missense	possibly damaging	0.78
R2941:Elmo1	UTSW	13	20600212	nonsense	probably null
R3508:Elmo1	UTSW	13	20605232	missense	probably damaging	1.00
R4344:Elmo1	UTSW	13	20261552	splice site	probably null
R4378:Elmo1	UTSW	13	20373116	missense	possibly damaging	0.96
R4423:Elmo1	UTSW	13	20600212	nonsense	probably null
R4425:Elmo1	UTSW	13	20600212	nonsense	probably null
R4516:Elmo1	UTSW	13	20282914	missense	probably benign	0.11
R4862:Elmo1	UTSW	13	20449512	missense	probably benign
R4990:Elmo1	UTSW	13	20342519	missense	probably damaging	1.00
R4991:Elmo1	UTSW	13	20342519	missense	probably damaging	1.00
R4992:Elmo1	UTSW	13	20342519	missense	probably damaging	1.00
R5197:Elmo1	UTSW	13	20564437	missense	probably benign	0.20
R5269:Elmo1	UTSW	13	20449486	missense	probably benign	0.00
R5386:Elmo1	UTSW	13	20600210	missense	probably benign	0.01
R5471:Elmo1	UTSW	13	20572385	missense	probably benign	0.01
R5922:Elmo1	UTSW	13	20605169	missense	probably damaging	1.00
R5947:Elmo1	UTSW	13	20290383	nonsense	probably null
R6512:Elmo1	UTSW	13	20373161	missense	probably damaging	1.00
R7338:Elmo1	UTSW	13	20280812	missense	probably benign	0.37
R7378:Elmo1	UTSW	13	20280935	missense	probably benign	0.00
R7477:Elmo1	UTSW	13	20285319	missense
R7593:Elmo1	UTSW	13	20290440	missense	probably benign
R7721:Elmo1	UTSW	13	20280803	splice site	probably null
R7778:Elmo1	UTSW	13	20589642	critical splice acceptor site	probably null
R8001:Elmo1	UTSW	13	20286732	missense	probably benign	0.05
R8133:Elmo1	UTSW	13	20373086	missense	probably damaging	1.00
R8248:Elmo1	UTSW	13	20600201	missense	probably damaging	1.00
R8685:Elmo1	UTSW	13	20290424	missense	possibly damaging	0.61
R8713:Elmo1	UTSW	13	20274621	critical splice donor site	probably benign
R8888:Elmo1	UTSW	13	20564460	missense	probably damaging	1.00
R8895:Elmo1	UTSW	13	20564460	missense	probably damaging	1.00
R8945:Elmo1	UTSW	13	20582268	nonsense	probably null
R9292:Elmo1	UTSW	13	20600259	critical splice donor site	probably null
R9389:Elmo1	UTSW	13	20185491	missense	probably benign	0.01
R9417:Elmo1	UTSW	13	20572403	missense	possibly damaging	0.57
R9472:Elmo1	UTSW	13	20286727	missense	probably benign	0.31
R9622:Elmo1	UTSW	13	20208140	missense	probably benign	0.01
R9661:Elmo1	UTSW	13	20285361	critical splice donor site	probably null
RF008:Elmo1	UTSW	13	20274536	missense	probably benign	0.32

Predicted Primers

PCR Primer
(F):5'- AAGAAGGCCGCTTATGCTCC -3'
(R):5'- AAGAACAGCCCTTTAGCTCC -3'

Sequencing Primer
(F):5'- ATGCTCCCTGCCCATCAG -3'
(R):5'- AACAGCCCTTTAGCTCCATGGATC -3'

Posted On

2018-06-06