Incidental Mutation 'R6531:Aldh5a1'
ID522374
Institutional Source Beutler Lab
Gene Symbol Aldh5a1
Ensembl Gene ENSMUSG00000035936
Gene Namealdhehyde dehydrogenase family 5, subfamily A1
SynonymsD630032B01Rik, SSADH, 6330403E24Rik, OTTMUSG00000000613
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R6531 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location24907579-24937661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24918564 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 305 (D305E)
Ref Sequence ENSEMBL: ENSMUSP00000040591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037615]
Predicted Effect probably benign
Transcript: ENSMUST00000037615
AA Change: D305E

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000040591
Gene: ENSMUSG00000035936
AA Change: D305E

DomainStartEndE-ValueType
Pfam:Aldedh 57 518 7.7e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151220
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. This gene encodes a mitochondrial NAD(+)-dependent succinic semialdehyde dehydrogenase. A deficiency of this enzyme, known as 4-hydroxybutyricaciduria, is a rare inborn error in the metabolism of the neurotransmitter 4-aminobutyric acid (GABA). In response to the defect, physiologic fluids from patients accumulate GHB, a compound with numerous neuromodulatory properties. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body weight, ataxia, seizures, gliosis of the hippocampus, and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Aldh5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Aldh5a1 APN 13 24926158 splice site probably benign
IGL01468:Aldh5a1 APN 13 24911553 utr 3 prime probably benign
IGL01538:Aldh5a1 APN 13 24918512 missense possibly damaging 0.90
IGL02839:Aldh5a1 APN 13 24911620 missense probably damaging 1.00
R0529:Aldh5a1 UTSW 13 24913873 missense probably benign 0.00
R1820:Aldh5a1 UTSW 13 24927572 missense probably benign 0.01
R2295:Aldh5a1 UTSW 13 24926099 missense probably damaging 1.00
R4231:Aldh5a1 UTSW 13 24911653 missense probably damaging 1.00
R4591:Aldh5a1 UTSW 13 24924008 missense probably damaging 1.00
R4865:Aldh5a1 UTSW 13 24911584 missense probably damaging 1.00
R5159:Aldh5a1 UTSW 13 24913793 missense possibly damaging 0.72
R5563:Aldh5a1 UTSW 13 24918626 missense possibly damaging 0.95
R6146:Aldh5a1 UTSW 13 24919678 critical splice donor site probably null
R6362:Aldh5a1 UTSW 13 24918550 missense probably benign 0.24
R6705:Aldh5a1 UTSW 13 24912270 missense probably damaging 1.00
R7151:Aldh5a1 UTSW 13 24937399 nonsense probably null
R7155:Aldh5a1 UTSW 13 24911589 missense possibly damaging 0.74
R7698:Aldh5a1 UTSW 13 24911748 missense probably damaging 0.99
R8027:Aldh5a1 UTSW 13 24926110 nonsense probably null
Z1177:Aldh5a1 UTSW 13 24911638 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCATGCCTGACAGAAAG -3'
(R):5'- TGGACATTTGGGCCATCAGAG -3'

Sequencing Primer
(F):5'- CTTGCTACACAATGACTGAGCAGATG -3'
(R):5'- TTTGGGCCATCAGAGGAAGGTAC -3'
Posted On2018-06-06