Incidental Mutation 'R6531:Zfp367'
ID522376
Institutional Source Beutler Lab
Gene Symbol Zfp367
Ensembl Gene ENSMUSG00000044934
Gene Namezinc finger protein 367
Synonyms8030486J21Rik, ZFF29a, ZFF29b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6531 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location64133018-64153202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64144250 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 189 (Y189C)
Ref Sequence ENSEMBL: ENSMUSP00000113331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059817] [ENSMUST00000117241]
Predicted Effect probably damaging
Transcript: ENSMUST00000059817
AA Change: Y189C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050854
Gene: ENSMUSG00000044934
AA Change: Y189C

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 105 113 N/A INTRINSIC
ZnF_C2H2 157 179 3.44e-4 SMART
ZnF_C2H2 185 209 2.4e-3 SMART
coiled coil region 299 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117241
AA Change: Y189C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113331
Gene: ENSMUSG00000044934
AA Change: Y189C

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 105 113 N/A INTRINSIC
ZnF_C2H2 157 179 3.44e-4 SMART
ZnF_C2H2 185 209 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152644
Meta Mutation Damage Score 0.8626 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Other mutations in Zfp367
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Zfp367 APN 13 64135439 missense probably damaging 1.00
IGL03151:Zfp367 APN 13 64145631 missense probably damaging 1.00
IGL03267:Zfp367 APN 13 64144283 splice site probably benign
R4608:Zfp367 UTSW 13 64135424 missense probably damaging 1.00
R6180:Zfp367 UTSW 13 64135390 missense probably damaging 1.00
R7727:Zfp367 UTSW 13 64145643 missense probably damaging 1.00
R8247:Zfp367 UTSW 13 64152668 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATAGCTTGGGGATGGGAGTTTA -3'
(R):5'- TTTATGGAGGAGAGGCGCTC -3'

Sequencing Primer
(F):5'- AGCTTGGGGATGGGAGTTTATGATG -3'
(R):5'- GCTCCAGTGCCACCCTTTG -3'
Posted On2018-06-06