Incidental Mutation 'R6564:Zic5'
ID522377
Institutional Source Beutler Lab
Gene Symbol Zic5
Ensembl Gene ENSMUSG00000041703
Gene Namezinc finger protein of the cerebellum 5
Synonymsodd-paired related, 1700049L20Rik, Opr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6564 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location122456795-122465677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122459421 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 594 (L594P)
Ref Sequence ENSEMBL: ENSMUSP00000035754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039118]
Predicted Effect unknown
Transcript: ENSMUST00000039118
AA Change: L594P
SMART Domains Protein: ENSMUSP00000035754
Gene: ENSMUSG00000041703
AA Change: L594P

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 116 154 N/A INTRINSIC
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
ZnF_C2H2 390 408 2.2e2 SMART
ZnF_C2H2 417 444 2.14e0 SMART
ZnF_C2H2 450 474 8.02e-5 SMART
ZnF_C2H2 480 504 2.53e-2 SMART
ZnF_C2H2 510 534 7.49e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143084
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 2, a related family member on chromosome 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality and reduced life spans with exencephaly, abnormal cerebral cortex and diencephalon morphology, abnormal gait and posture, and impaired growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,486,077 probably null Het
4931429L15Rik C A 9: 46,306,904 D179Y probably damaging Het
Abca1 A T 4: 53,034,031 L2233Q possibly damaging Het
Abca12 T A 1: 71,309,850 E834V possibly damaging Het
Abcc9 T C 6: 142,603,108 Y1318C probably damaging Het
Adam15 C A 3: 89,347,212 R121L possibly damaging Het
Afdn T A 17: 13,896,089 M1588K probably benign Het
Akap9 T C 5: 4,028,491 S1849P probably damaging Het
Bag6 T C 17: 35,140,371 S213P probably damaging Het
Bpifb9a T C 2: 154,260,178 V65A probably benign Het
Chn1 T A 2: 73,618,041 I203F probably damaging Het
Crnkl1 T A 2: 145,928,245 E226V possibly damaging Het
Cspg4 A G 9: 56,890,158 E1302G probably benign Het
Dnah5 G T 15: 28,367,745 A2759S probably benign Het
Doxl2 T C 6: 48,977,575 V549A probably benign Het
Dtx1 T A 5: 120,695,017 T119S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ezr C T 17: 6,742,847 V268M probably damaging Het
Fbxl15 T C 19: 46,329,338 V153A probably damaging Het
Fkbpl C A 17: 34,646,266 A336E probably benign Het
Gsg1l2 A G 11: 67,786,504 T200A possibly damaging Het
H2afx T C 9: 44,334,912 Y51H probably damaging Het
Ifi213 A C 1: 173,595,296 M1R probably null Het
Kcnt1 A C 2: 25,911,051 D1045A probably benign Het
Kdm4a C A 4: 118,177,439 A32S probably benign Het
Klkb1 A T 8: 45,273,634 V444E probably damaging Het
Mccc1 T C 3: 35,976,676 T414A probably damaging Het
Miga1 A C 3: 152,285,322 N367K probably damaging Het
Mmp7 A G 9: 7,695,184 D49G probably benign Het
Nlrp1a A G 11: 71,123,572 L284P probably damaging Het
Olfr1411 T C 1: 92,596,563 S15P probably benign Het
Olfr853 G A 9: 19,537,210 T240I possibly damaging Het
Pbld1 T A 10: 63,072,027 I224N possibly damaging Het
Pih1d1 A T 7: 45,159,819 R276W probably damaging Het
Plekhg1 G T 10: 3,964,153 V1292L probably damaging Het
Prex2 A G 1: 11,101,061 probably null Het
Rbm6 T C 9: 107,833,498 Y498C probably damaging Het
Reps1 T A 10: 18,122,392 probably null Het
Ruvbl1 T A 6: 88,479,226 I154N possibly damaging Het
Slc4a5 T G 6: 83,280,060 F616V possibly damaging Het
Spag5 A T 11: 78,315,575 T798S probably damaging Het
Spam1 T A 6: 24,796,356 I102K possibly damaging Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svs3a T A 2: 164,289,350 I21K probably damaging Het
Tet3 T A 6: 83,386,070 I842L possibly damaging Het
Tlr2 T A 3: 83,837,695 K360N probably benign Het
Tmem45b C G 9: 31,428,005 W138S probably damaging Het
Tpgs2 T C 18: 25,158,287 E40G probably damaging Het
Traj40 T C 14: 54,177,942 probably benign Het
Trpm5 A G 7: 143,072,770 S125P probably damaging Het
Ttc3 G T 16: 94,442,611 C1158F probably damaging Het
Tubg1 T C 11: 101,120,889 I74T probably damaging Het
Vav2 A T 2: 27,279,185 probably null Het
Wbp4 G T 14: 79,467,428 H201N probably damaging Het
Wdhd1 A G 14: 47,248,042 S821P probably benign Het
Wsb2 A T 5: 117,370,560 probably null Het
Other mutations in Zic5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Zic5 APN 14 122459512 missense unknown
Ezekiel UTSW 14 122465154 missense unknown
R0227:Zic5 UTSW 14 122459661 missense unknown
R0646:Zic5 UTSW 14 122463939 missense unknown
R1327:Zic5 UTSW 14 122459779 splice site probably benign
R1387:Zic5 UTSW 14 122459485 missense unknown
R1665:Zic5 UTSW 14 122459527 missense unknown
R2020:Zic5 UTSW 14 122464830 missense unknown
R2571:Zic5 UTSW 14 122459478 missense unknown
R4241:Zic5 UTSW 14 122464663 missense probably benign 0.03
R4610:Zic5 UTSW 14 122464800 missense probably damaging 0.98
R4706:Zic5 UTSW 14 122459557 missense unknown
R5496:Zic5 UTSW 14 122459343 missense unknown
R6178:Zic5 UTSW 14 122459336 missense unknown
R6189:Zic5 UTSW 14 122464974 missense unknown
R6332:Zic5 UTSW 14 122459749 missense unknown
R6485:Zic5 UTSW 14 122459640 missense unknown
R6677:Zic5 UTSW 14 122465154 missense unknown
R6877:Zic5 UTSW 14 122459688 missense unknown
R6977:Zic5 UTSW 14 122459548 missense unknown
R6977:Zic5 UTSW 14 122459555 small deletion probably benign
R6978:Zic5 UTSW 14 122459548 missense unknown
R6978:Zic5 UTSW 14 122459555 small deletion probably benign
R6996:Zic5 UTSW 14 122464668 missense probably benign 0.02
R7713:Zic5 UTSW 14 122464113 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAATTAGACCCGGTGGCAAG -3'
(R):5'- GAAGCACATGAAGATTCACTGC -3'

Sequencing Primer
(F):5'- GCAAGTCTGAGTCACCAGTTTGTC -3'
(R):5'- TGAAGATTCACTGCAAGTCCC -3'
Posted On2018-06-06