Mutagenetix > Incidental Mutation

Incidental Mutation 'R6531:Krt78'

522380

Institutional Source

Beutler Lab

Gene Symbol

Krt78

Ensembl Gene

ENSMUSG00000050463

Gene Name

keratin 78

Synonyms

2310030B04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R6531 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101946001-101954287 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101952273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 200 (Y200H)

Ref Sequence

ENSEMBL: ENSMUSP00000126197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164932]

AlphaFold

E9Q0F0

Predicted Effect

probably benign
Transcript: ENSMUST00000164932
AA Change: Y200H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000126197
Gene: ENSMUSG00000050463
AA Change: Y200H

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	2	101	5.7e-16	PFAM
Filament	104	417	1.38e-133	SMART
internal_repeat_1	421	660	8.87e-74	PROSPERO
internal_repeat_1	704	957	8.87e-74	PROSPERO
low complexity region	1033	1049	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.2%
20x: 90.6%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin gene family and encodes a protein with an intermediate filament domain. Keratins are the major structural proteins in epithelial cells, forming a cytoplasmic network of 10 to 12 nm wide intermediate filaments and creating a scaffold that gives cells the ability to withstand mechanical and non-mechanical stresses. The genes of the type II keratin family are located as a gene cluster at 12p13.13. Four pseudogenes of this gene family have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,949,999	E880G	possibly damaging	Het
Acsbg2	T	A	17: 56,846,617	I529F	probably damaging	Het
Ahcyl2	T	G	6: 29,886,162	M359R	probably benign	Het
Aldh5a1	G	T	13: 24,918,564	D305E	probably benign	Het
Catsper2	C	G	2: 121,399,780	V358L	possibly damaging	Het
Cd200r4	C	T	16: 44,833,505	Q222*	probably null	Het
Col4a2	T	A	8: 11,408,135	D270E	probably benign	Het
Cux1	T	C	5: 136,275,119	D1401G	probably benign	Het
Cyp3a59	T	A	5: 146,098,217	M235K	probably benign	Het
Dock3	T	C	9: 106,967,216	D895G	probably benign	Het
Dusp27	A	T	1: 166,110,046		probably null	Het
Dync1h1	T	C	12: 110,617,920	F586L	probably damaging	Het
Elmo1	G	T	13: 20,572,446	R568L	possibly damaging	Het
Epb41	T	C	4: 131,957,636	T711A	probably benign	Het
Grm7	T	A	6: 111,358,425	M599K	probably benign	Het
Hivep3	A	T	4: 120,122,876	K1704*	probably null	Het
Ighv1-62-3	C	A	12: 115,461,006	C115F	probably damaging	Het
Lamb2	A	T	9: 108,483,726	H549L	possibly damaging	Het
Mroh3	A	G	1: 136,184,353	I759T	probably benign	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Nol6	G	T	4: 41,118,154	P828T	probably benign	Het
Olfr1030	A	G	2: 85,984,307	I156V	probably benign	Het
Olfr1132	A	G	2: 87,635,529	Y73H	probably damaging	Het
Olfr1264	A	G	2: 90,021,457	V203A	probably benign	Het
Olfr344	G	A	2: 36,569,341	V248I	probably damaging	Het
Ovgp1	A	C	3: 105,987,071		probably benign	Het
Pitpnm3	T	A	11: 72,071,487	Q230L	possibly damaging	Het
Pkn1	C	T	8: 83,670,293	V910I	probably benign	Het
Plcb1	T	A	2: 135,325,802		probably null	Het
Ppp1r12c	A	G	7: 4,482,789		probably null	Het
Rassf5	T	A	1: 131,244,814	Q106L	possibly damaging	Het
Rfc1	T	C	5: 65,312,979	K62E	possibly damaging	Het
Sf3b1	C	T	1: 55,019,395	E12K	probably damaging	Het
Slc4a1ap	A	T	5: 31,548,638	D691V	probably benign	Het
Speg	T	A	1: 75,422,757	F2283I	probably benign	Het
Synj2	A	G	17: 6,033,839	K267E	probably damaging	Het
Tg	A	T	15: 66,839,362	Y991F	probably damaging	Het
Tlk1	A	T	2: 70,742,083	D380E	probably benign	Het
Trim43b	A	T	9: 89,085,365	L405H	probably damaging	Het
Ttf2	A	G	3: 100,956,260	I586T	probably damaging	Het
Ugt2b36	T	A	5: 87,081,586	R213S	probably damaging	Het
Vmn1r198	T	A	13: 22,354,407	M21K	probably benign	Het
Wdr35	A	T	12: 8,978,685	Y101F	probably benign	Het
Zfp367	T	C	13: 64,144,250	Y189C	probably damaging	Het

Other mutations in Krt78

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Krt78	APN	15	101947510	missense	probably benign	0.28
IGL01358:Krt78	APN	15	101946263	missense	probably benign	0.18
IGL01723:Krt78	APN	15	101951798	missense	possibly damaging	0.65
IGL01743:Krt78	APN	15	101950898	missense	probably benign	0.06
IGL01778:Krt78	APN	15	101950967	missense	probably damaging	1.00
IGL01792:Krt78	APN	15	101946650	missense	probably benign	0.01
IGL02271:Krt78	APN	15	101948593	missense	probably benign	0.02
IGL02481:Krt78	APN	15	101948418	splice site	probably benign
IGL02494:Krt78	APN	15	101954051	missense	probably benign	0.00
IGL02708:Krt78	APN	15	101953407	missense	possibly damaging	0.88
IGL02747:Krt78	APN	15	101950384	splice site	probably benign
IGL02997:Krt78	APN	15	101947163	missense	probably benign	0.11
IGL03350:Krt78	APN	15	101946517	missense	probably benign	0.02
IGL03410:Krt78	APN	15	101953986	missense	probably damaging	0.99
PIT4812001:Krt78	UTSW	15	101948069	missense	probably damaging	1.00
R0090:Krt78	UTSW	15	101947837	missense	probably benign	0.35
R0513:Krt78	UTSW	15	101950949	missense	probably damaging	1.00
R0908:Krt78	UTSW	15	101950901	missense	probably damaging	1.00
R1067:Krt78	UTSW	15	101946461	nonsense	probably null
R1070:Krt78	UTSW	15	101946293	missense	possibly damaging	0.86
R1194:Krt78	UTSW	15	101951786	missense	probably damaging	0.99
R1213:Krt78	UTSW	15	101951810	missense	probably benign	0.10
R1467:Krt78	UTSW	15	101946293	missense	possibly damaging	0.86
R1467:Krt78	UTSW	15	101946293	missense	possibly damaging	0.86
R1612:Krt78	UTSW	15	101951844	splice site	probably null
R1750:Krt78	UTSW	15	101946377	missense	probably benign	0.33
R1796:Krt78	UTSW	15	101950865	missense	probably damaging	1.00
R1863:Krt78	UTSW	15	101946569	missense	possibly damaging	0.53
R1901:Krt78	UTSW	15	101946963	nonsense	probably null
R1902:Krt78	UTSW	15	101946963	nonsense	probably null
R1975:Krt78	UTSW	15	101946168	makesense	probably null
R2105:Krt78	UTSW	15	101947414	missense	possibly damaging	0.93
R2418:Krt78	UTSW	15	101946634	missense	probably benign
R2421:Krt78	UTSW	15	101947264	missense	probably damaging	0.96
R2422:Krt78	UTSW	15	101947264	missense	probably damaging	0.96
R2443:Krt78	UTSW	15	101946598	missense	probably damaging	1.00
R2897:Krt78	UTSW	15	101947106	missense	probably benign
R4422:Krt78	UTSW	15	101947940	missense	probably benign	0.13
R4424:Krt78	UTSW	15	101947940	missense	probably benign	0.13
R4425:Krt78	UTSW	15	101947940	missense	probably benign	0.13
R4583:Krt78	UTSW	15	101946620	missense	possibly damaging	0.53
R4752:Krt78	UTSW	15	101948202	missense	probably benign	0.05
R4927:Krt78	UTSW	15	101946899	missense	probably benign	0.02
R5129:Krt78	UTSW	15	101947580	missense	possibly damaging	0.70
R5391:Krt78	UTSW	15	101951828	nonsense	probably null
R5575:Krt78	UTSW	15	101947352	nonsense	probably null
R5617:Krt78	UTSW	15	101947609	missense	probably damaging	0.99
R5806:Krt78	UTSW	15	101950502	missense	probably damaging	1.00
R5906:Krt78	UTSW	15	101948595	missense	probably damaging	0.98
R5993:Krt78	UTSW	15	101950449	missense	probably damaging	1.00
R6520:Krt78	UTSW	15	101951771	missense	probably benign	0.26
R6587:Krt78	UTSW	15	101952269	missense	probably benign	0.10
R6749:Krt78	UTSW	15	101950923	missense	probably damaging	1.00
R7126:Krt78	UTSW	15	101948436	missense	probably damaging	1.00
R7158:Krt78	UTSW	15	101951806	missense	probably benign	0.17
R7229:Krt78	UTSW	15	101947394	missense	probably benign	0.01
R7523:Krt78	UTSW	15	101946601	missense	not run
R7638:Krt78	UTSW	15	101950883	missense	probably damaging	1.00
R7879:Krt78	UTSW	15	101948189	missense	probably benign	0.22
R8013:Krt78	UTSW	15	101948542	missense	probably damaging	0.99
R8085:Krt78	UTSW	15	101947280	missense	possibly damaging	0.91
R8209:Krt78	UTSW	15	101947045	missense	possibly damaging	0.56
R8226:Krt78	UTSW	15	101947045	missense	possibly damaging	0.56
R8309:Krt78	UTSW	15	101946487	missense	probably benign	0.00
R8728:Krt78	UTSW	15	101947790	missense	probably benign	0.11
R8729:Krt78	UTSW	15	101947020	missense	probably damaging	0.98
R8887:Krt78	UTSW	15	101953311	missense	probably damaging	1.00
R9008:Krt78	UTSW	15	101946776	small deletion	probably benign
X0018:Krt78	UTSW	15	101951800	missense	possibly damaging	0.96
Z1088:Krt78	UTSW	15	101947331	missense	possibly damaging	0.91
Z1177:Krt78	UTSW	15	101947660	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TATCCCATCCTGTCAGAGGG -3'
(R):5'- ATCAAAACACGTGGCCTGC -3'

Sequencing Primer
(F):5'- GGTGACTACATTCAGAGTGCC -3'
(R):5'- CTGGGATACAGGCTGAGAGTC -3'

Posted On

2018-06-06