Incidental Mutation 'R6531:Krt78'
ID522380
Institutional Source Beutler Lab
Gene Symbol Krt78
Ensembl Gene ENSMUSG00000050463
Gene Namekeratin 78
Synonyms2310030B04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6531 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101946001-101954287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101952273 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 200 (Y200H)
Ref Sequence ENSEMBL: ENSMUSP00000126197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164932]
Predicted Effect probably benign
Transcript: ENSMUST00000164932
AA Change: Y200H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126197
Gene: ENSMUSG00000050463
AA Change: Y200H

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 101 5.7e-16 PFAM
Filament 104 417 1.38e-133 SMART
internal_repeat_1 421 660 8.87e-74 PROSPERO
internal_repeat_1 704 957 8.87e-74 PROSPERO
low complexity region 1033 1049 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin gene family and encodes a protein with an intermediate filament domain. Keratins are the major structural proteins in epithelial cells, forming a cytoplasmic network of 10 to 12 nm wide intermediate filaments and creating a scaffold that gives cells the ability to withstand mechanical and non-mechanical stresses. The genes of the type II keratin family are located as a gene cluster at 12p13.13. Four pseudogenes of this gene family have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Krt78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt78 APN 15 101947510 missense probably benign 0.28
IGL01358:Krt78 APN 15 101946263 missense probably benign 0.18
IGL01723:Krt78 APN 15 101951798 missense possibly damaging 0.65
IGL01743:Krt78 APN 15 101950898 missense probably benign 0.06
IGL01778:Krt78 APN 15 101950967 missense probably damaging 1.00
IGL01792:Krt78 APN 15 101946650 missense probably benign 0.01
IGL02271:Krt78 APN 15 101948593 missense probably benign 0.02
IGL02481:Krt78 APN 15 101948418 splice site probably benign
IGL02494:Krt78 APN 15 101954051 missense probably benign 0.00
IGL02708:Krt78 APN 15 101953407 missense possibly damaging 0.88
IGL02747:Krt78 APN 15 101950384 splice site probably benign
IGL02997:Krt78 APN 15 101947163 missense probably benign 0.11
IGL03350:Krt78 APN 15 101946517 missense probably benign 0.02
IGL03410:Krt78 APN 15 101953986 missense probably damaging 0.99
PIT4812001:Krt78 UTSW 15 101948069 missense probably damaging 1.00
R0090:Krt78 UTSW 15 101947837 missense probably benign 0.35
R0513:Krt78 UTSW 15 101950949 missense probably damaging 1.00
R0908:Krt78 UTSW 15 101950901 missense probably damaging 1.00
R1067:Krt78 UTSW 15 101946461 nonsense probably null
R1070:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1194:Krt78 UTSW 15 101951786 missense probably damaging 0.99
R1213:Krt78 UTSW 15 101951810 missense probably benign 0.10
R1467:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1467:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1612:Krt78 UTSW 15 101951844 splice site probably null
R1750:Krt78 UTSW 15 101946377 missense probably benign 0.33
R1796:Krt78 UTSW 15 101950865 missense probably damaging 1.00
R1863:Krt78 UTSW 15 101946569 missense possibly damaging 0.53
R1901:Krt78 UTSW 15 101946963 nonsense probably null
R1902:Krt78 UTSW 15 101946963 nonsense probably null
R1975:Krt78 UTSW 15 101946168 makesense probably null
R2105:Krt78 UTSW 15 101947414 missense possibly damaging 0.93
R2418:Krt78 UTSW 15 101946634 missense probably benign
R2421:Krt78 UTSW 15 101947264 missense probably damaging 0.96
R2422:Krt78 UTSW 15 101947264 missense probably damaging 0.96
R2443:Krt78 UTSW 15 101946598 missense probably damaging 1.00
R2897:Krt78 UTSW 15 101947106 missense probably benign
R4422:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4424:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4425:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4583:Krt78 UTSW 15 101946620 missense possibly damaging 0.53
R4752:Krt78 UTSW 15 101948202 missense probably benign 0.05
R4927:Krt78 UTSW 15 101946899 missense probably benign 0.02
R5129:Krt78 UTSW 15 101947580 missense possibly damaging 0.70
R5391:Krt78 UTSW 15 101951828 nonsense probably null
R5575:Krt78 UTSW 15 101947352 nonsense probably null
R5617:Krt78 UTSW 15 101947609 missense probably damaging 0.99
R5806:Krt78 UTSW 15 101950502 missense probably damaging 1.00
R5906:Krt78 UTSW 15 101948595 missense probably damaging 0.98
R5993:Krt78 UTSW 15 101950449 missense probably damaging 1.00
R6520:Krt78 UTSW 15 101951771 missense probably benign 0.26
R6587:Krt78 UTSW 15 101952269 missense probably benign 0.10
R6749:Krt78 UTSW 15 101950923 missense probably damaging 1.00
R7126:Krt78 UTSW 15 101948436 missense probably damaging 1.00
R7158:Krt78 UTSW 15 101951806 missense probably benign 0.17
R7229:Krt78 UTSW 15 101947394 missense probably benign 0.01
R7523:Krt78 UTSW 15 101946601 missense not run
R7638:Krt78 UTSW 15 101950883 missense probably damaging 1.00
R7879:Krt78 UTSW 15 101948189 missense probably benign 0.22
R8013:Krt78 UTSW 15 101948542 missense probably damaging 0.99
R8085:Krt78 UTSW 15 101947280 missense possibly damaging 0.91
R8209:Krt78 UTSW 15 101947045 missense possibly damaging 0.56
R8226:Krt78 UTSW 15 101947045 missense possibly damaging 0.56
R8309:Krt78 UTSW 15 101946487 missense probably benign 0.00
X0018:Krt78 UTSW 15 101951800 missense possibly damaging 0.96
Z1088:Krt78 UTSW 15 101947331 missense possibly damaging 0.91
Z1177:Krt78 UTSW 15 101947660 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCCCATCCTGTCAGAGGG -3'
(R):5'- ATCAAAACACGTGGCCTGC -3'

Sequencing Primer
(F):5'- GGTGACTACATTCAGAGTGCC -3'
(R):5'- CTGGGATACAGGCTGAGAGTC -3'
Posted On2018-06-06