Incidental Mutation 'R6531:Ncbp2'
ID 522382
Institutional Source Beutler Lab
Gene Symbol Ncbp2
Ensembl Gene ENSMUSG00000022774
Gene Name nuclear cap binding protein subunit 2
Synonyms 20kDa
MMRRC Submission 044657-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6531 (G1)
Quality Score 217.468
Status Validated
Chromosome 16
Chromosomal Location 31948513-31961781 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CGTCTGGATG to CG at 31956343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023460] [ENSMUST00000115178] [ENSMUST00000126215] [ENSMUST00000231360]
AlphaFold Q9CQ49
Predicted Effect probably null
Transcript: ENSMUST00000023460
SMART Domains Protein: ENSMUSP00000023460
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
RRM 41 114 6.96e-23 SMART
low complexity region 122 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115178
SMART Domains Protein: ENSMUSP00000110832
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
PDB:3FEY|B 1 103 7e-42 PDB
Blast:RRM 41 61 2e-6 BLAST
SCOP:d1qm9a1 41 97 4e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140965
Predicted Effect probably benign
Transcript: ENSMUST00000231360
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Ncbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02875:Ncbp2 APN 16 31954153 missense probably damaging 1.00
R1929:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2185:Ncbp2 UTSW 16 31956377 missense probably damaging 1.00
R2270:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2271:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2272:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R6405:Ncbp2 UTSW 16 31956343 frame shift probably null
R6406:Ncbp2 UTSW 16 31956341 frame shift probably null
R6406:Ncbp2 UTSW 16 31956343 frame shift probably null
R6444:Ncbp2 UTSW 16 31956343 frame shift probably null
R6446:Ncbp2 UTSW 16 31956343 frame shift probably null
R6448:Ncbp2 UTSW 16 31956343 frame shift probably null
R6530:Ncbp2 UTSW 16 31956343 frame shift probably null
R9556:Ncbp2 UTSW 16 31956940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGAAGTCGTGTTAGACCA -3'
(R):5'- CACTAACAAGCACAAGTTCCTT -3'

Sequencing Primer
(F):5'- CCAGAAGTCGTGTTAGACCAACTTTG -3'
(R):5'- TAACAAGCACAAGTTCCTTACAAAAG -3'
Posted On 2018-06-06