Incidental Mutation 'R6531:Acsbg2'
ID522387
Institutional Source Beutler Lab
Gene Symbol Acsbg2
Ensembl Gene ENSMUSG00000024207
Gene Nameacyl-CoA synthetase bubblegum family member 2
SynonymsBgr
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6531 (G1)
Quality Score184.009
Status Validated
Chromosome17
Chromosomal Location56843103-56874447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56846617 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 529 (I529F)
Ref Sequence ENSEMBL: ENSMUSP00000042352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043062]
Predicted Effect probably damaging
Transcript: ENSMUST00000043062
AA Change: I529F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042352
Gene: ENSMUSG00000024207
AA Change: I529F

DomainStartEndE-ValueType
Pfam:AMP-binding 53 519 7e-93 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,949,999 E880G possibly damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in Acsbg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Acsbg2 APN 17 56861621 missense possibly damaging 0.90
IGL02119:Acsbg2 APN 17 56868459 splice site probably benign
IGL02418:Acsbg2 APN 17 56849730 missense probably benign
R0023:Acsbg2 UTSW 17 56847710 missense probably damaging 0.98
R0023:Acsbg2 UTSW 17 56847710 missense probably damaging 0.98
R0149:Acsbg2 UTSW 17 56853924 splice site probably benign
R1542:Acsbg2 UTSW 17 56849791 missense probably damaging 1.00
R2014:Acsbg2 UTSW 17 56853855 missense possibly damaging 0.52
R4170:Acsbg2 UTSW 17 56853846 missense probably benign 0.00
R4465:Acsbg2 UTSW 17 56861580 missense probably damaging 1.00
R4867:Acsbg2 UTSW 17 56862914 missense possibly damaging 0.93
R5169:Acsbg2 UTSW 17 56849913 missense probably benign 0.07
R5524:Acsbg2 UTSW 17 56850197 missense probably damaging 1.00
R6521:Acsbg2 UTSW 17 56861565 missense probably benign 0.00
R7126:Acsbg2 UTSW 17 56846633 missense probably damaging 0.99
R7167:Acsbg2 UTSW 17 56857000 missense probably benign 0.44
R7423:Acsbg2 UTSW 17 56868257 missense probably benign
R7970:Acsbg2 UTSW 17 56849728 missense probably benign 0.43
R8023:Acsbg2 UTSW 17 56845448 missense probably damaging 1.00
R8104:Acsbg2 UTSW 17 56845443 missense probably benign 0.27
Z1177:Acsbg2 UTSW 17 56853898 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GACAACCTGTCACCATGCTC -3'
(R):5'- ACTCAGATGTTGGGAGAATGC -3'

Sequencing Primer
(F):5'- AGTCTGGGGTCAGCCAC -3'
(R):5'- CAGGAGTGAGTGGGGACTTG -3'
Posted On2018-06-06