Incidental Mutation 'R6531:Acsbg2'
ID 522387
Institutional Source Beutler Lab
Gene Symbol Acsbg2
Ensembl Gene ENSMUSG00000024207
Gene Name acyl-CoA synthetase bubblegum family member 2
Synonyms Bgr
MMRRC Submission 044657-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R6531 (G1)
Quality Score 184.009
Status Validated
Chromosome 17
Chromosomal Location 57150103-57181447 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57153617 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 529 (I529F)
Ref Sequence ENSEMBL: ENSMUSP00000042352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043062]
AlphaFold Q2XU92
Predicted Effect probably damaging
Transcript: ENSMUST00000043062
AA Change: I529F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042352
Gene: ENSMUSG00000024207
AA Change: I529F

DomainStartEndE-ValueType
Pfam:AMP-binding 53 519 7e-93 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,926,980 (GRCm39) E880G possibly damaging Het
Ahcyl2 T G 6: 29,886,161 (GRCm39) M359R probably benign Het
Aldh5a1 G T 13: 25,102,547 (GRCm39) D305E probably benign Het
Catsper2 C G 2: 121,230,261 (GRCm39) V358L possibly damaging Het
Cd200r4 C T 16: 44,653,868 (GRCm39) Q222* probably null Het
Col4a2 T A 8: 11,458,135 (GRCm39) D270E probably benign Het
Cux1 T C 5: 136,303,973 (GRCm39) D1401G probably benign Het
Cyp3a59 T A 5: 146,035,027 (GRCm39) M235K probably benign Het
Dock3 T C 9: 106,844,415 (GRCm39) D895G probably benign Het
Dync1h1 T C 12: 110,584,354 (GRCm39) F586L probably damaging Het
Elmo1 G T 13: 20,756,616 (GRCm39) R568L possibly damaging Het
Epb41 T C 4: 131,684,947 (GRCm39) T711A probably benign Het
Grm7 T A 6: 111,335,386 (GRCm39) M599K probably benign Het
Hivep3 A T 4: 119,980,073 (GRCm39) K1704* probably null Het
Ighv1-62-3 C A 12: 115,424,626 (GRCm39) C115F probably damaging Het
Krt78 A G 15: 101,860,708 (GRCm39) Y200H probably benign Het
Lamb2 A T 9: 108,360,925 (GRCm39) H549L possibly damaging Het
Mroh3 A G 1: 136,112,091 (GRCm39) I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,775,161 (GRCm39) probably null Het
Nol6 G T 4: 41,118,154 (GRCm39) P828T probably benign Het
Or1j15 G A 2: 36,459,353 (GRCm39) V248I probably damaging Het
Or4c3 A G 2: 89,851,801 (GRCm39) V203A probably benign Het
Or5m5 A G 2: 85,814,651 (GRCm39) I156V probably benign Het
Or8w1 A G 2: 87,465,873 (GRCm39) Y73H probably damaging Het
Ovgp1 A C 3: 105,894,387 (GRCm39) probably benign Het
Pitpnm3 T A 11: 71,962,313 (GRCm39) Q230L possibly damaging Het
Pkn1 C T 8: 84,396,922 (GRCm39) V910I probably benign Het
Plcb1 T A 2: 135,167,722 (GRCm39) probably null Het
Ppp1r12c A G 7: 4,485,788 (GRCm39) probably null Het
Rassf5 T A 1: 131,172,551 (GRCm39) Q106L possibly damaging Het
Rfc1 T C 5: 65,470,322 (GRCm39) K62E possibly damaging Het
Sf3b1 C T 1: 55,058,554 (GRCm39) E12K probably damaging Het
Slc4a1ap A T 5: 31,705,982 (GRCm39) D691V probably benign Het
Speg T A 1: 75,399,401 (GRCm39) F2283I probably benign Het
Styxl2 A T 1: 165,937,615 (GRCm39) probably null Het
Synj2 A G 17: 6,084,114 (GRCm39) K267E probably damaging Het
Tg A T 15: 66,711,211 (GRCm39) Y991F probably damaging Het
Tlk1 A T 2: 70,572,427 (GRCm39) D380E probably benign Het
Trim43b A T 9: 88,967,418 (GRCm39) L405H probably damaging Het
Ttf2 A G 3: 100,863,576 (GRCm39) I586T probably damaging Het
Ugt2b36 T A 5: 87,229,445 (GRCm39) R213S probably damaging Het
Vmn1r198 T A 13: 22,538,577 (GRCm39) M21K probably benign Het
Wdr35 A T 12: 9,028,685 (GRCm39) Y101F probably benign Het
Zfp367 T C 13: 64,292,064 (GRCm39) Y189C probably damaging Het
Other mutations in Acsbg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Acsbg2 APN 17 57,168,621 (GRCm39) missense possibly damaging 0.90
IGL02119:Acsbg2 APN 17 57,175,459 (GRCm39) splice site probably benign
IGL02418:Acsbg2 APN 17 57,156,730 (GRCm39) missense probably benign
R0023:Acsbg2 UTSW 17 57,154,710 (GRCm39) missense probably damaging 0.98
R0023:Acsbg2 UTSW 17 57,154,710 (GRCm39) missense probably damaging 0.98
R0149:Acsbg2 UTSW 17 57,160,924 (GRCm39) splice site probably benign
R1542:Acsbg2 UTSW 17 57,156,791 (GRCm39) missense probably damaging 1.00
R2014:Acsbg2 UTSW 17 57,160,855 (GRCm39) missense possibly damaging 0.52
R4170:Acsbg2 UTSW 17 57,160,846 (GRCm39) missense probably benign 0.00
R4465:Acsbg2 UTSW 17 57,168,580 (GRCm39) missense probably damaging 1.00
R4867:Acsbg2 UTSW 17 57,169,914 (GRCm39) missense possibly damaging 0.93
R5169:Acsbg2 UTSW 17 57,156,913 (GRCm39) missense probably benign 0.07
R5524:Acsbg2 UTSW 17 57,157,197 (GRCm39) missense probably damaging 1.00
R6521:Acsbg2 UTSW 17 57,168,565 (GRCm39) missense probably benign 0.00
R7126:Acsbg2 UTSW 17 57,153,633 (GRCm39) missense probably damaging 0.99
R7167:Acsbg2 UTSW 17 57,164,000 (GRCm39) missense probably benign 0.44
R7423:Acsbg2 UTSW 17 57,175,257 (GRCm39) missense probably benign
R7970:Acsbg2 UTSW 17 57,156,728 (GRCm39) missense probably benign 0.43
R8023:Acsbg2 UTSW 17 57,152,448 (GRCm39) missense probably damaging 1.00
R8104:Acsbg2 UTSW 17 57,152,443 (GRCm39) missense probably benign 0.27
R8887:Acsbg2 UTSW 17 57,175,285 (GRCm39) missense probably benign 0.25
Z1177:Acsbg2 UTSW 17 57,160,898 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GACAACCTGTCACCATGCTC -3'
(R):5'- ACTCAGATGTTGGGAGAATGC -3'

Sequencing Primer
(F):5'- AGTCTGGGGTCAGCCAC -3'
(R):5'- CAGGAGTGAGTGGGGACTTG -3'
Posted On 2018-06-06