Incidental Mutation 'R6532:Slc25a54'
ID522405
Institutional Source Beutler Lab
Gene Symbol Slc25a54
Ensembl Gene ENSMUSG00000027880
Gene Namesolute carrier family 25, member 54
Synonyms4930443G12Rik, SCaMC-1like
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R6532 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location109080469-109116687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109112052 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 324 (Y324C)
Ref Sequence ENSEMBL: ENSMUSP00000029478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029478] [ENSMUST00000159926]
Predicted Effect probably damaging
Transcript: ENSMUST00000029478
AA Change: Y324C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029478
Gene: ENSMUSG00000027880
AA Change: Y324C

DomainStartEndE-ValueType
EFh 23 51 4.28e0 SMART
EFh 59 87 3.82e0 SMART
EFh 90 118 4.12e-3 SMART
EFh 126 154 3.44e1 SMART
Pfam:Mito_carr 191 283 3.7e-25 PFAM
Pfam:Mito_carr 284 376 7.2e-24 PFAM
Pfam:Mito_carr 383 472 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159926
SMART Domains Protein: ENSMUSP00000124484
Gene: ENSMUSG00000027880

DomainStartEndE-ValueType
Blast:EFh 1 21 6e-9 BLAST
Pfam:Mito_carr 57 150 3.2e-26 PFAM
Pfam:Mito_carr 151 243 3.6e-25 PFAM
Pfam:Mito_carr 249 339 1.5e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,977,379 L1418P probably damaging Het
Adal A G 2: 121,146,123 probably null Het
Akap2 T C 4: 57,855,174 F168L probably benign Het
Atr T A 9: 95,908,408 N1600K probably benign Het
Cubn T C 2: 13,459,002 T631A probably benign Het
Dpp9 C T 17: 56,205,854 G118D possibly damaging Het
Ear1 C T 14: 43,819,252 R53H probably benign Het
Exoc1 T C 5: 76,537,837 V132A probably damaging Het
Fam227a C T 15: 79,636,720 R301Q probably benign Het
Garnl3 A T 2: 33,031,119 M298K possibly damaging Het
Glb1l3 T C 9: 26,818,442 D619G probably benign Het
Haspin A T 11: 73,137,551 C237* probably null Het
Hook1 T G 4: 96,019,756 probably null Het
Hoxa7 A G 6: 52,217,315 F31L probably benign Het
Hoxb7 C A 11: 96,286,888 S54* probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Inca1 T C 11: 70,695,907 M1V probably null Het
Kcnt2 A G 1: 140,584,106 T933A probably damaging Het
Lama4 G A 10: 39,048,077 D494N possibly damaging Het
Lrp1 A C 10: 127,541,682 H4133Q probably damaging Het
Lrp1 A G 10: 127,549,407 F3542L probably damaging Het
Myo1f A G 17: 33,575,846 D20G probably damaging Het
Nlk G T 11: 78,696,055 A71E probably damaging Het
Nvl G A 1: 181,144,143 probably null Het
Olfr1154 A T 2: 87,903,202 I158N probably damaging Het
Pcnx C A 12: 81,980,964 H1601N probably damaging Het
Pnkp T A 7: 44,857,405 M1K probably null Het
Skiv2l G A 17: 34,844,743 R575C probably damaging Het
Tdrd3 A G 14: 87,505,816 E400G probably damaging Het
Unc5b A G 10: 60,778,828 I230T possibly damaging Het
Wfdc2 A G 2: 164,563,376 T50A probably benign Het
Zfp563 A G 17: 33,105,698 I422M probably benign Het
Other mutations in Slc25a54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Slc25a54 APN 3 109112860 missense possibly damaging 0.76
IGL02635:Slc25a54 APN 3 109112817 missense possibly damaging 0.71
IGL02944:Slc25a54 APN 3 109080615 missense probably benign 0.14
IGL02987:Slc25a54 APN 3 109116337 missense probably benign
IGL03346:Slc25a54 APN 3 109085730 intron probably benign
R0491:Slc25a54 UTSW 3 109102796 missense probably damaging 1.00
R0520:Slc25a54 UTSW 3 109107230 splice site probably benign
R0645:Slc25a54 UTSW 3 109112165 missense possibly damaging 0.70
R1803:Slc25a54 UTSW 3 109102697 missense probably benign
R1869:Slc25a54 UTSW 3 109080616 nonsense probably null
R1870:Slc25a54 UTSW 3 109080616 nonsense probably null
R3024:Slc25a54 UTSW 3 109080666 missense probably damaging 1.00
R3763:Slc25a54 UTSW 3 109112054 missense probably damaging 1.00
R3930:Slc25a54 UTSW 3 109116504 missense probably benign 0.03
R3941:Slc25a54 UTSW 3 109112163 missense probably damaging 1.00
R4346:Slc25a54 UTSW 3 109102739 missense possibly damaging 0.52
R4347:Slc25a54 UTSW 3 109102739 missense possibly damaging 0.52
R4445:Slc25a54 UTSW 3 109098668 missense probably benign 0.00
R4735:Slc25a54 UTSW 3 109098607 missense probably damaging 0.96
R4914:Slc25a54 UTSW 3 109111079 missense probably benign 0.34
R4960:Slc25a54 UTSW 3 109112816 missense possibly damaging 0.95
R5052:Slc25a54 UTSW 3 109102700 missense probably benign 0.03
R5106:Slc25a54 UTSW 3 109112864 missense probably benign 0.02
R5806:Slc25a54 UTSW 3 109080578 missense probably benign
R5936:Slc25a54 UTSW 3 109098638 missense possibly damaging 0.88
R6511:Slc25a54 UTSW 3 109094256 missense possibly damaging 0.92
R6879:Slc25a54 UTSW 3 109112834 missense possibly damaging 0.94
R7139:Slc25a54 UTSW 3 109098589 missense probably damaging 1.00
R7179:Slc25a54 UTSW 3 109107257 missense probably benign 0.00
R7282:Slc25a54 UTSW 3 109116501 nonsense probably null
R7336:Slc25a54 UTSW 3 109116435 missense probably benign 0.00
R7355:Slc25a54 UTSW 3 109102769 missense probably damaging 1.00
R7713:Slc25a54 UTSW 3 109102817 missense probably damaging 0.99
R8061:Slc25a54 UTSW 3 109111045 missense probably damaging 1.00
R8282:Slc25a54 UTSW 3 109098689 critical splice donor site probably null
Z1176:Slc25a54 UTSW 3 109112118 frame shift probably null
Z1177:Slc25a54 UTSW 3 109102797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATAGGTTTTGAACAGGAG -3'
(R):5'- CAAATGTAATGCACAATGCCAG -3'

Sequencing Primer
(F):5'- GTTAGCCTGGAAGTCACTATTCAGC -3'
(R):5'- GTAATGCACAATGCCAGACTTCTGAG -3'
Posted On2018-06-06