Incidental Mutation 'R6562:Pkn3'
ID522406
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Nameprotein kinase N3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30077684-30091022 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 30080687 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000125346] [ENSMUST00000150770]
Predicted Effect probably null
Transcript: ENSMUST00000045246
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125346
SMART Domains Protein: ENSMUSP00000120268
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 19 82 3.45e-17 SMART
Hr1 102 170 6.19e-19 SMART
Hr1 175 238 6.4e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148650
Predicted Effect probably benign
Transcript: ENSMUST00000150770
SMART Domains Protein: ENSMUSP00000114492
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 28 91 3.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156197
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 30081104 missense probably damaging 0.97
IGL00781:Pkn3 APN 2 30083390 unclassified probably benign
IGL00815:Pkn3 APN 2 30081200 missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 30087042 missense probably damaging 1.00
IGL01897:Pkn3 APN 2 30082812 unclassified probably benign
IGL02513:Pkn3 APN 2 30083137 missense probably damaging 0.98
IGL02552:Pkn3 APN 2 30080867 missense probably damaging 1.00
IGL02622:Pkn3 APN 2 30083146 missense probably benign 0.28
IGL02689:Pkn3 APN 2 30080846 missense probably damaging 1.00
IGL02996:Pkn3 APN 2 30080615 missense probably benign 0.39
IGL03106:Pkn3 APN 2 30085245 missense probably damaging 0.96
Enflamme UTSW 2 30083037 unclassified probably benign
Wrath UTSW 2 30088584 critical splice donor site probably null
PIT4151001:Pkn3 UTSW 2 30090527 missense probably damaging 1.00
R0279:Pkn3 UTSW 2 30083297 missense probably benign 0.16
R0370:Pkn3 UTSW 2 30087172 missense probably damaging 1.00
R0491:Pkn3 UTSW 2 30089877 missense probably damaging 1.00
R0600:Pkn3 UTSW 2 30081134 missense probably benign 0.06
R1418:Pkn3 UTSW 2 30083047 missense probably damaging 1.00
R1510:Pkn3 UTSW 2 30079764 critical splice donor site probably null
R1535:Pkn3 UTSW 2 30087053 missense probably benign
R1540:Pkn3 UTSW 2 30084691 missense probably damaging 1.00
R1808:Pkn3 UTSW 2 30079651 missense probably damaging 1.00
R1884:Pkn3 UTSW 2 30082828 missense probably damaging 1.00
R1995:Pkn3 UTSW 2 30089977 missense probably damaging 1.00
R3745:Pkn3 UTSW 2 30090341 missense probably damaging 1.00
R4119:Pkn3 UTSW 2 30083037 unclassified probably benign
R4258:Pkn3 UTSW 2 30088560 missense probably damaging 0.99
R4665:Pkn3 UTSW 2 30085457 unclassified probably benign
R4772:Pkn3 UTSW 2 30084680 splice site probably null
R4808:Pkn3 UTSW 2 30090081 missense probably damaging 1.00
R5038:Pkn3 UTSW 2 30085281 critical splice donor site probably null
R5388:Pkn3 UTSW 2 30081074 missense probably damaging 0.99
R5488:Pkn3 UTSW 2 30088584 critical splice donor site probably null
R5611:Pkn3 UTSW 2 30079661 missense probably damaging 1.00
R6001:Pkn3 UTSW 2 30088584 critical splice donor site probably null
R6277:Pkn3 UTSW 2 30082945 missense possibly damaging 0.93
R6724:Pkn3 UTSW 2 30090550 missense possibly damaging 0.94
R7061:Pkn3 UTSW 2 30083536 intron probably null
R7128:Pkn3 UTSW 2 30083315 missense probably damaging 1.00
R7249:Pkn3 UTSW 2 30084761 missense probably benign 0.00
R7475:Pkn3 UTSW 2 30087110 missense probably benign 0.01
R7746:Pkn3 UTSW 2 30090584 missense probably benign 0.00
R7747:Pkn3 UTSW 2 30090584 missense probably benign 0.00
R7783:Pkn3 UTSW 2 30079622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGAACCTTGGTATAACAGGG -3'
(R):5'- CTGTAGAGACAGCAGTGAGC -3'

Sequencing Primer
(F):5'- CCTTGGTATAACAGGGGAGGCTC -3'
(R):5'- ACACAGCCTGACCTCGG -3'
Posted On2018-06-06