Incidental Mutation 'R6562:L3mbtl1'
ID522410
Institutional Source Beutler Lab
Gene Symbol L3mbtl1
Ensembl Gene ENSMUSG00000035576
Gene NameL3MBTL1 histone methyl-lysine binding protein
SynonymsL3MBTL1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6562 (G1)
Quality Score210.009
Status Validated
Chromosome2
Chromosomal Location162943472-162974522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 162970204 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 723 (T723I)
Ref Sequence ENSEMBL: ENSMUSP00000044038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035751]
Predicted Effect probably benign
Transcript: ENSMUST00000035751
AA Change: T723I

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044038
Gene: ENSMUSG00000035576
AA Change: T723I

DomainStartEndE-ValueType
low complexity region 234 242 N/A INTRINSIC
MBT 280 380 5.34e-53 SMART
MBT 388 487 2.17e-53 SMART
MBT 496 591 1.49e-51 SMART
Pfam:zf-C2HC 627 655 1.7e-17 PFAM
SAM 754 821 3.49e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153416
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a polycomb group gene. The encoded protein functions to regulate gene activity, likely via chromatin modification. The encoded protein may also be necessary for mitosis. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal nervous system phenotype, hematopoietic system phenotype, immune system phenotype, cellular phenotype, and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Tmem67 A G 4: 12,053,445 probably null Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in L3mbtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:L3mbtl1 APN 2 162967063 missense probably damaging 1.00
IGL01090:L3mbtl1 APN 2 162966005 missense probably damaging 1.00
IGL01291:L3mbtl1 APN 2 162970180 missense probably benign 0.30
IGL02897:L3mbtl1 APN 2 162965772 missense probably damaging 1.00
IGL02974:L3mbtl1 APN 2 162970183 missense possibly damaging 0.68
IGL02986:L3mbtl1 APN 2 162970305 missense probably damaging 1.00
IGL03057:L3mbtl1 APN 2 162967383 missense probably damaging 1.00
IGL03372:L3mbtl1 APN 2 162971157 splice site probably benign
ANU05:L3mbtl1 UTSW 2 162970180 missense probably benign 0.30
R0006:L3mbtl1 UTSW 2 162964569 missense possibly damaging 0.94
R0006:L3mbtl1 UTSW 2 162964569 missense possibly damaging 0.94
R0067:L3mbtl1 UTSW 2 162948828 missense probably damaging 1.00
R0067:L3mbtl1 UTSW 2 162948828 missense probably damaging 1.00
R0078:L3mbtl1 UTSW 2 162947226 missense probably benign 0.12
R0505:L3mbtl1 UTSW 2 162947335 splice site probably benign
R0748:L3mbtl1 UTSW 2 162971163 splice site probably benign
R0748:L3mbtl1 UTSW 2 162971164 critical splice acceptor site probably null
R0761:L3mbtl1 UTSW 2 162966047 missense probably damaging 1.00
R1789:L3mbtl1 UTSW 2 162974502 missense probably benign
R1970:L3mbtl1 UTSW 2 162959572 missense probably damaging 1.00
R2114:L3mbtl1 UTSW 2 162960070 splice site probably null
R2115:L3mbtl1 UTSW 2 162960070 splice site probably null
R2116:L3mbtl1 UTSW 2 162960070 splice site probably null
R2117:L3mbtl1 UTSW 2 162960070 splice site probably null
R2513:L3mbtl1 UTSW 2 162967585 missense probably benign
R3848:L3mbtl1 UTSW 2 162948201 missense probably damaging 1.00
R4877:L3mbtl1 UTSW 2 162948568 missense probably damaging 0.98
R4930:L3mbtl1 UTSW 2 162965772 missense probably damaging 1.00
R5930:L3mbtl1 UTSW 2 162967336 small deletion probably benign
R5932:L3mbtl1 UTSW 2 162967336 small deletion probably benign
R6601:L3mbtl1 UTSW 2 162948175 start gained probably benign
R6995:L3mbtl1 UTSW 2 162961448 missense probably damaging 1.00
R7188:L3mbtl1 UTSW 2 162949540 critical splice donor site probably null
R7346:L3mbtl1 UTSW 2 162967006 missense probably benign 0.01
R7379:L3mbtl1 UTSW 2 162960979 missense probably damaging 1.00
R7474:L3mbtl1 UTSW 2 162966604 missense probably damaging 1.00
R7553:L3mbtl1 UTSW 2 162948231 missense probably benign 0.01
R7599:L3mbtl1 UTSW 2 162964514 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GTAACCCCACCCGCTGTG -3'
(R):5'- CTCCTGTGAGGGTTAGAGGG -3'

Sequencing Primer
(F):5'- TTTCAGAAGGGGCCATGT -3'
(R):5'- CCAGACAGGGTTTCTCTGTATAGC -3'
Posted On2018-06-06