Incidental Mutation 'R6562:Tmem67'
ID522426
Institutional Source Beutler Lab
Gene Symbol Tmem67
Ensembl Gene ENSMUSG00000049488
Gene Nametransmembrane protein 67
Synonymsb2b1291.1Clo, 5330408M12Rik, b2b1163.1Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6562 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location12039355-12090020 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 12053445 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050686] [ENSMUST00000108293]
Predicted Effect probably null
Transcript: ENSMUST00000050686
SMART Domains Protein: ENSMUSP00000052644
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 17 23 N/A INTRINSIC
Pfam:Meckelin 166 995 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108293
SMART Domains Protein: ENSMUSP00000103928
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
Pfam:Meckelin 236 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131145
SMART Domains Protein: ENSMUSP00000115154
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal/postanal lethality, kidney cysts, and Meckel-Gruber or Joubert syndrome-like phenotypes depending on the filial generation of the backcross to C57BL/6J. Mice homozygous for an ENU-induced allele exhibit cardiovascular defects and cystic kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,362 T1246S possibly damaging Het
4933434E20Rik A G 3: 90,063,236 K26E probably benign Het
Abt1 T G 13: 23,423,588 E82A probably damaging Het
Actr8 A G 14: 29,986,454 probably null Het
Akap12 G T 10: 4,356,141 E984* probably null Het
Ankrd13a C A 5: 114,804,392 probably benign Het
Ankrd13c T A 3: 157,999,672 S411T probably damaging Het
Arhgef28 A G 13: 97,988,139 probably null Het
Arhgef3 A T 14: 27,152,996 probably benign Het
Atad5 T C 11: 80,133,206 S1712P probably benign Het
Bbs12 A G 3: 37,320,240 E394G probably damaging Het
Ccdc158 T G 5: 92,662,722 K102N probably damaging Het
Ccdc169 A G 3: 55,150,814 N89S probably damaging Het
Cenpu T C 8: 46,572,823 I132T possibly damaging Het
Cnrip1 G A 11: 17,078,539 W157* probably null Het
Ctnnd1 A G 2: 84,624,308 S53P probably benign Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Dock7 A T 4: 98,991,410 V969D probably damaging Het
Ehd2 C A 7: 15,957,567 R280L probably benign Het
Entpd5 T C 12: 84,386,200 T218A probably damaging Het
Fcrls A C 3: 87,257,328 I297S probably benign Het
Frmpd2 T A 14: 33,571,915 L1346Q probably benign Het
Fry T C 5: 150,326,149 S142P probably damaging Het
Gbgt1 A T 2: 28,504,886 I179F probably damaging Het
Gm17067 A T 7: 42,708,729 S116R probably damaging Het
Gm5565 G T 5: 146,158,154 P261T probably damaging Het
Gm609 C T 16: 45,444,079 E39K probably benign Het
Kat6a T C 8: 22,911,787 F391L probably benign Het
Kcnmb4 A T 10: 116,473,184 probably null Het
Krt6a T A 15: 101,691,659 H386L probably benign Het
L3mbtl1 C T 2: 162,970,204 T723I probably benign Het
Lamb2 A T 9: 108,487,008 R1049W possibly damaging Het
Lrmda T C 14: 22,598,186 probably benign Het
Lysmd2 C T 9: 75,635,409 T95I unknown Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nin T C 12: 70,055,954 D300G probably damaging Het
Nutf2 G T 8: 105,875,626 D23Y probably benign Het
Olfr801 G A 10: 129,670,139 P127S probably damaging Het
Ovgp1 A G 3: 105,980,273 Y300C probably damaging Het
Pgghg A G 7: 140,946,593 I633V probably benign Het
Pik3r3 C T 4: 116,299,809 Q496* probably null Het
Pkn3 G T 2: 30,080,687 probably null Het
Plin2 A T 4: 86,658,595 S298T probably benign Het
Prdm8 T C 5: 98,183,343 V18A possibly damaging Het
Rel C A 11: 23,757,026 G59* probably null Het
Siglecg A G 7: 43,409,057 R123G possibly damaging Het
Slc13a1 T A 6: 24,150,793 I49F probably benign Het
Slc39a10 T A 1: 46,835,564 T193S probably benign Het
Slc9a3 T A 13: 74,155,161 V191E probably damaging Het
Sult2b1 A C 7: 45,742,246 S39A probably benign Het
Tead1 A G 7: 112,861,443 T185A probably benign Het
Trim12c A T 7: 104,345,134 probably null Het
Trpm6 T A 19: 18,838,042 F1164Y probably damaging Het
Ube2d1 C T 10: 71,262,241 D16N probably benign Het
Vmn2r24 A T 6: 123,780,427 I85F probably benign Het
Vwde T A 6: 13,193,123 N406Y possibly damaging Het
Wdr54 A T 6: 83,155,068 probably null Het
Zcchc14 A T 8: 121,604,103 N840K probably damaging Het
Zfp451 C A 1: 33,762,179 S1052I possibly damaging Het
Other mutations in Tmem67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Tmem67 APN 4 12061826 missense probably damaging 0.98
IGL00768:Tmem67 APN 4 12055029 critical splice donor site probably null
IGL00813:Tmem67 APN 4 12058587 splice site probably benign
IGL01070:Tmem67 APN 4 12054750 missense probably benign 0.20
IGL01088:Tmem67 APN 4 12063126 missense probably damaging 1.00
IGL01353:Tmem67 APN 4 12079895 missense probably damaging 1.00
IGL01490:Tmem67 APN 4 12057422 splice site probably benign
IGL01885:Tmem67 APN 4 12057389 missense probably damaging 1.00
IGL02061:Tmem67 APN 4 12053526 missense probably damaging 1.00
IGL02151:Tmem67 APN 4 12068882 missense probably benign 0.35
IGL02166:Tmem67 APN 4 12047313 missense possibly damaging 0.90
IGL02243:Tmem67 APN 4 12070584 missense possibly damaging 0.93
IGL02517:Tmem67 APN 4 12069463 missense possibly damaging 0.67
IGL02736:Tmem67 APN 4 12045789 splice site probably null
R0282:Tmem67 UTSW 4 12087930 missense probably damaging 0.99
R0514:Tmem67 UTSW 4 12089317 missense probably benign
R1221:Tmem67 UTSW 4 12045871 missense possibly damaging 0.92
R1301:Tmem67 UTSW 4 12089400 unclassified probably benign
R1581:Tmem67 UTSW 4 12047814 missense probably damaging 1.00
R1680:Tmem67 UTSW 4 12087840 missense probably benign 0.00
R1804:Tmem67 UTSW 4 12045789 splice site probably null
R2174:Tmem67 UTSW 4 12063730 nonsense probably null
R2191:Tmem67 UTSW 4 12069413 critical splice donor site probably null
R2246:Tmem67 UTSW 4 12040651 missense probably damaging 1.00
R2566:Tmem67 UTSW 4 12079918 missense probably damaging 0.99
R3409:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R3410:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R4078:Tmem67 UTSW 4 12040633 critical splice donor site probably null
R4282:Tmem67 UTSW 4 12073922 missense probably damaging 0.99
R4429:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4430:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4431:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4734:Tmem67 UTSW 4 12063158 missense probably benign 0.00
R4856:Tmem67 UTSW 4 12089416 unclassified probably benign
R4865:Tmem67 UTSW 4 12070262 missense probably benign 0.01
R5056:Tmem67 UTSW 4 12070471 missense probably benign 0.29
R5575:Tmem67 UTSW 4 12047886 missense possibly damaging 0.93
R5614:Tmem67 UTSW 4 12061755 missense possibly damaging 0.54
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6182:Tmem67 UTSW 4 12051402 missense probably benign 0.05
R6574:Tmem67 UTSW 4 12063086 missense possibly damaging 0.70
R6696:Tmem67 UTSW 4 12061754 critical splice donor site probably null
R6824:Tmem67 UTSW 4 12051449 missense probably damaging 1.00
R7028:Tmem67 UTSW 4 12075484 missense probably benign 0.12
R7174:Tmem67 UTSW 4 12077337 missense possibly damaging 0.82
R7369:Tmem67 UTSW 4 12053535 missense probably damaging 1.00
R7638:Tmem67 UTSW 4 12079883 missense probably benign 0.17
R7671:Tmem67 UTSW 4 12063698 missense probably benign 0.00
R7736:Tmem67 UTSW 4 12053455 missense probably benign 0.09
R8005:Tmem67 UTSW 4 12047821 missense probably damaging 1.00
Z1176:Tmem67 UTSW 4 12087983 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAGGCCCCATCACATCGTATTTAAG -3'
(R):5'- GCAAAGGGAAAGTGCTGTACTC -3'

Sequencing Primer
(F):5'- CCATCACATCGTATTTAAGTTTTGC -3'
(R):5'- GAAAGTGCTGTACTCACGTGATCTC -3'
Posted On2018-06-06